Incidental Mutation 'R6672:Zfp605'
ID527166
Institutional Source Beutler Lab
Gene Symbol Zfp605
Ensembl Gene ENSMUSG00000023284
Gene Namezinc finger protein 605
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6672 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location110110092-110129794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110127997 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 327 (H327R)
Ref Sequence ENSEMBL: ENSMUSP00000108147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086686] [ENSMUST00000112528] [ENSMUST00000147631]
Predicted Effect probably damaging
Transcript: ENSMUST00000086686
AA Change: H327R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083891
Gene: ENSMUSG00000023284
AA Change: H327R

DomainStartEndE-ValueType
KRAB 6 66 3.75e-28 SMART
low complexity region 147 159 N/A INTRINSIC
ZnF_C2H2 200 222 1.36e-2 SMART
ZnF_C2H2 228 250 4.38e1 SMART
ZnF_C2H2 305 327 1.18e-2 SMART
ZnF_C2H2 333 355 5.14e-3 SMART
ZnF_C2H2 361 383 9.73e-4 SMART
ZnF_C2H2 389 411 4.99e1 SMART
ZnF_C2H2 443 465 5.4e1 SMART
ZnF_C2H2 471 493 1.3e-4 SMART
ZnF_C2H2 499 521 4.24e-4 SMART
ZnF_C2H2 527 549 1.95e-3 SMART
ZnF_C2H2 555 577 2.09e-3 SMART
ZnF_C2H2 583 605 1.2e-3 SMART
ZnF_C2H2 611 633 1.79e-2 SMART
ZnF_C2H2 639 661 2.53e-2 SMART
ZnF_C2H2 667 689 2.09e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112528
AA Change: H327R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108147
Gene: ENSMUSG00000023284
AA Change: H327R

DomainStartEndE-ValueType
KRAB 6 66 3.75e-28 SMART
low complexity region 147 159 N/A INTRINSIC
ZnF_C2H2 200 222 1.36e-2 SMART
ZnF_C2H2 228 250 4.38e1 SMART
ZnF_C2H2 305 327 1.18e-2 SMART
ZnF_C2H2 333 355 5.14e-3 SMART
ZnF_C2H2 361 383 9.73e-4 SMART
ZnF_C2H2 389 411 4.99e1 SMART
ZnF_C2H2 443 465 5.4e1 SMART
ZnF_C2H2 471 493 1.3e-4 SMART
ZnF_C2H2 499 521 4.24e-4 SMART
ZnF_C2H2 527 549 1.95e-3 SMART
ZnF_C2H2 555 577 2.09e-3 SMART
ZnF_C2H2 583 605 1.2e-3 SMART
ZnF_C2H2 611 633 1.79e-2 SMART
ZnF_C2H2 639 661 2.53e-2 SMART
ZnF_C2H2 667 689 2.09e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144089
Predicted Effect probably benign
Transcript: ENSMUST00000147631
SMART Domains Protein: ENSMUSP00000122236
Gene: ENSMUSG00000023284

DomainStartEndE-ValueType
KRAB 6 66 3.75e-28 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 40,681,533 E680G probably benign Het
Adam7 T A 14: 68,504,702 probably null Het
Arid2 C T 15: 96,362,345 T351I probably benign Het
Asz1 T A 6: 18,075,818 E252V possibly damaging Het
BC024978 C T 7: 27,204,064 probably benign Het
Chrm5 C T 2: 112,479,796 C325Y probably benign Het
Cyp2c65 A G 19: 39,087,674 R357G probably damaging Het
Dhx36 A G 3: 62,495,536 V265A probably damaging Het
Dhx36 T A 3: 62,500,879 E179D probably benign Het
Dip2c G A 13: 9,567,830 probably null Het
Dock10 A T 1: 80,512,531 M1958K probably benign Het
Dpf1 T C 7: 29,316,268 C357R probably damaging Het
Dync1h1 C T 12: 110,658,134 R3703C probably damaging Het
Eef1g A G 19: 8,967,047 probably null Het
Gnl2 T C 4: 125,048,393 V397A probably damaging Het
Gramd3 A G 18: 56,432,336 E21G possibly damaging Het
Grik3 C A 4: 125,623,516 Q51K probably benign Het
Hectd2 G T 19: 36,587,380 Q20H probably damaging Het
Krtap5-1 A G 7: 142,296,496 C192R unknown Het
Lrpap1 A T 5: 35,099,233 M135K probably benign Het
Lrrc9 G A 12: 72,473,936 R664H possibly damaging Het
Mef2c T G 13: 83,652,856 V225G probably damaging Het
Nlrp9b T C 7: 20,019,338 L56P probably damaging Het
Nup133 T C 8: 123,916,281 probably null Het
Odf3 A G 7: 140,848,427 S25G probably benign Het
Olfr533 G A 7: 140,466,735 C178Y probably damaging Het
Olfr993 T A 2: 85,414,604 I92L possibly damaging Het
Ppp1r3d T C 2: 178,413,759 E150G possibly damaging Het
Smpd1 A G 7: 105,555,273 M120V probably benign Het
Zbtb46 A G 2: 181,411,836 L361P probably benign Het
Other mutations in Zfp605
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02388:Zfp605 APN 5 110127640 missense possibly damaging 0.95
R0010:Zfp605 UTSW 5 110127534 missense probably benign 0.03
R0357:Zfp605 UTSW 5 110124379 missense probably benign
R0383:Zfp605 UTSW 5 110128854 missense probably damaging 1.00
R1017:Zfp605 UTSW 5 110127994 missense probably benign 0.42
R1663:Zfp605 UTSW 5 110127585 missense probably benign 0.02
R1688:Zfp605 UTSW 5 110129041 missense possibly damaging 0.83
R1752:Zfp605 UTSW 5 110123773 missense probably damaging 1.00
R1994:Zfp605 UTSW 5 110127552 missense probably damaging 1.00
R2173:Zfp605 UTSW 5 110127457 missense probably benign 0.00
R3740:Zfp605 UTSW 5 110128698 missense probably damaging 1.00
R3742:Zfp605 UTSW 5 110128698 missense probably damaging 1.00
R3981:Zfp605 UTSW 5 110127738 missense probably damaging 1.00
R4095:Zfp605 UTSW 5 110127736 missense probably damaging 1.00
R4349:Zfp605 UTSW 5 110128686 missense probably damaging 1.00
R4669:Zfp605 UTSW 5 110127361 missense possibly damaging 0.94
R4914:Zfp605 UTSW 5 110127701 nonsense probably null
R4994:Zfp605 UTSW 5 110127486 missense probably damaging 1.00
R6814:Zfp605 UTSW 5 110127445 missense probably benign 0.00
R6872:Zfp605 UTSW 5 110127445 missense probably benign 0.00
R7251:Zfp605 UTSW 5 110127960 missense probably damaging 1.00
R7395:Zfp605 UTSW 5 110112019 start gained probably benign
R7560:Zfp605 UTSW 5 110127291 nonsense probably null
R7623:Zfp605 UTSW 5 110127520 missense probably benign 0.03
R7965:Zfp605 UTSW 5 110127450 missense probably benign 0.00
R7999:Zfp605 UTSW 5 110128434 missense probably damaging 1.00
R8307:Zfp605 UTSW 5 110128197 missense probably damaging 1.00
R8355:Zfp605 UTSW 5 110111982 start gained probably benign
R8455:Zfp605 UTSW 5 110111982 start gained probably benign
X0063:Zfp605 UTSW 5 110123848 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCAGAGAACTCACACTGG -3'
(R):5'- AGGAGCTGTGACTTTTCAGG -3'

Sequencing Primer
(F):5'- GACAGAAGCCCTATGCACGTG -3'
(R):5'- GGTTTTCCGATGAAGGCCTCAC -3'
Posted On2018-07-23