Incidental Mutation 'R6672:Asz1'
ID527167
Institutional Source Beutler Lab
Gene Symbol Asz1
Ensembl Gene ENSMUSG00000010796
Gene Nameankyrin repeat, SAM and basic leucine zipper domain containing 1
Synonyms4933400N19Rik, ORF3, Gasz
MMRRC Submission
Accession Numbers

Genbank: NM_023729.3

Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R6672 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location18050964-18109061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18075818 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 252 (E252V)
Ref Sequence ENSEMBL: ENSMUSP00000010940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010940] [ENSMUST00000136194]
Predicted Effect possibly damaging
Transcript: ENSMUST00000010940
AA Change: E252V

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000010940
Gene: ENSMUSG00000010796
AA Change: E252V

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
ANK 45 74 4.86e1 SMART
ANK 78 107 4.03e-5 SMART
ANK 110 144 2.3e0 SMART
ANK 148 177 3.46e-4 SMART
ANK 181 210 1.05e-3 SMART
SAM 271 336 5.64e-3 SMART
Blast:ANK 385 414 5e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131614
Predicted Effect probably benign
Transcript: ENSMUST00000136194
SMART Domains Protein: ENSMUSP00000122680
Gene: ENSMUSG00000010796

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
ANK 45 74 4.86e1 SMART
ANK 78 107 4.03e-5 SMART
ANK 110 144 2.3e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146216
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (31/31)
MGI Phenotype PHENOTYPE: Homozygous null male mice are sterile resulting from a block in spermatid development [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 40,681,533 E680G probably benign Het
Adam7 T A 14: 68,504,702 probably null Het
Arid2 C T 15: 96,362,345 T351I probably benign Het
BC024978 C T 7: 27,204,064 probably benign Het
Chrm5 C T 2: 112,479,796 C325Y probably benign Het
Cyp2c65 A G 19: 39,087,674 R357G probably damaging Het
Dhx36 A G 3: 62,495,536 V265A probably damaging Het
Dhx36 T A 3: 62,500,879 E179D probably benign Het
Dip2c G A 13: 9,567,830 probably null Het
Dock10 A T 1: 80,512,531 M1958K probably benign Het
Dpf1 T C 7: 29,316,268 C357R probably damaging Het
Dync1h1 C T 12: 110,658,134 R3703C probably damaging Het
Eef1g A G 19: 8,967,047 probably null Het
Gnl2 T C 4: 125,048,393 V397A probably damaging Het
Gramd3 A G 18: 56,432,336 E21G possibly damaging Het
Grik3 C A 4: 125,623,516 Q51K probably benign Het
Hectd2 G T 19: 36,587,380 Q20H probably damaging Het
Krtap5-1 A G 7: 142,296,496 C192R unknown Het
Lrpap1 A T 5: 35,099,233 M135K probably benign Het
Lrrc9 G A 12: 72,473,936 R664H possibly damaging Het
Mef2c T G 13: 83,652,856 V225G probably damaging Het
Nlrp9b T C 7: 20,019,338 L56P probably damaging Het
Nup133 T C 8: 123,916,281 probably null Het
Odf3 A G 7: 140,848,427 S25G probably benign Het
Olfr533 G A 7: 140,466,735 C178Y probably damaging Het
Olfr993 T A 2: 85,414,604 I92L possibly damaging Het
Ppp1r3d T C 2: 178,413,759 E150G possibly damaging Het
Smpd1 A G 7: 105,555,273 M120V probably benign Het
Zbtb46 A G 2: 181,411,836 L361P probably benign Het
Zfp605 A G 5: 110,127,997 H327R probably damaging Het
Other mutations in Asz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Asz1 APN 6 18055542 critical splice acceptor site probably null
IGL02691:Asz1 APN 6 18076557 missense probably damaging 1.00
IGL02958:Asz1 APN 6 18073814 missense possibly damaging 0.92
IGL03116:Asz1 APN 6 18076643 splice site probably benign
H9600:Asz1 UTSW 6 18055425 splice site probably benign
R0331:Asz1 UTSW 6 18103619 splice site probably benign
R3441:Asz1 UTSW 6 18108406 missense probably benign 0.06
R3896:Asz1 UTSW 6 18075767 missense probably benign 0.17
R4596:Asz1 UTSW 6 18103593 missense possibly damaging 0.82
R4683:Asz1 UTSW 6 18055542 critical splice acceptor site probably benign
R5304:Asz1 UTSW 6 18076620 missense probably benign 0.11
R5869:Asz1 UTSW 6 18074940 unclassified probably benign
R6550:Asz1 UTSW 6 18051381 missense probably damaging 0.96
R6850:Asz1 UTSW 6 18108943 missense probably benign 0.00
R6894:Asz1 UTSW 6 18055521 missense probably damaging 1.00
R7092:Asz1 UTSW 6 18071819 splice site probably null
R7388:Asz1 UTSW 6 18074901 missense probably benign 0.04
R7608:Asz1 UTSW 6 18077253 missense probably damaging 1.00
R7885:Asz1 UTSW 6 18104877 missense probably damaging 1.00
R7994:Asz1 UTSW 6 18054641 missense probably benign 0.04
R8913:Asz1 UTSW 6 18054571 missense probably benign 0.00
X0054:Asz1 UTSW 6 18055481 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTTCTAAACTCTAGAGAACAAGGC -3'
(R):5'- GAAGCCTTTACTTGGTTTTACAGAAGG -3'

Sequencing Primer
(F):5'- AGGCATCTAAAATCCAGACATTTC -3'
(R):5'- AGTTATAAGTCTTTGAACCACTTACC -3'
Posted On2018-07-23