Incidental Mutation 'R6672:Smpd1'
ID527171
Institutional Source Beutler Lab
Gene Symbol Smpd1
Ensembl Gene ENSMUSG00000037049
Gene Namesphingomyelin phosphodiesterase 1, acid lysosomal
SynonymsASM, aSMase, A-SMase, acid sphingomyelinase, Zn-SMase
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R6672 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location105554360-105558389 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105555273 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 120 (M120V)
Ref Sequence ENSEMBL: ENSMUSP00000042187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046983] [ENSMUST00000081165] [ENSMUST00000186814] [ENSMUST00000187057] [ENSMUST00000188001] [ENSMUST00000188368] [ENSMUST00000189072] [ENSMUST00000189265] [ENSMUST00000189378] [ENSMUST00000190369] [ENSMUST00000191011] [ENSMUST00000191601]
Predicted Effect probably benign
Transcript: ENSMUST00000046983
AA Change: M120V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042187
Gene: ENSMUSG00000037049
AA Change: M120V

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
SapB 85 163 1.05e-7 SMART
low complexity region 177 196 N/A INTRINSIC
Pfam:Metallophos 197 459 4.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081165
SMART Domains Protein: ENSMUSP00000079932
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 4.16e-38 SMART
PTB 538 667 1.76e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186814
Predicted Effect probably benign
Transcript: ENSMUST00000187057
SMART Domains Protein: ENSMUSP00000139899
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
WW 31 62 3.7e-7 SMART
low complexity region 64 76 N/A INTRINSIC
PTB 142 287 3.8e-41 SMART
PTB 313 442 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188001
Predicted Effect probably benign
Transcript: ENSMUST00000188368
SMART Domains Protein: ENSMUSP00000139788
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
WW 31 62 3.7e-7 SMART
low complexity region 64 76 N/A INTRINSIC
PTB 142 289 1.8e-40 SMART
PTB 315 444 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189072
SMART Domains Protein: ENSMUSP00000139575
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189265
SMART Domains Protein: ENSMUSP00000140137
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:PID 1 34 2.3e-6 PFAM
PTB 63 192 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189378
SMART Domains Protein: ENSMUSP00000140979
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190369
SMART Domains Protein: ENSMUSP00000140486
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191011
SMART Domains Protein: ENSMUSP00000140973
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191250
Predicted Effect probably benign
Transcript: ENSMUST00000191601
SMART Domains Protein: ENSMUSP00000140116
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 3.7e-7 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 1.8e-40 SMART
PTB 538 667 9.5e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211307
Predicted Effect probably benign
Transcript: ENSMUST00000211614
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a lysosomal acid sphingomyelinase that converts sphingomyelin to ceramide. The encoded protein also has phospholipase C activity. Defects in this gene are a cause of Niemann-Pick disease type A (NPA) and Niemann-Pick disease type B (NPB). Multiple transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2010]
PHENOTYPE: Nullizygous mutations cause tremors, ataxia, altered lipid homeostasis, increased foam cell number, Purkinje cell loss and premature death, and may lead to hepatosplenomegaly, hunched posture, reduced weight, abnormal apoptosis, sperm defects, dyspnea, and high susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 40,681,533 E680G probably benign Het
Adam7 T A 14: 68,504,702 probably null Het
Arid2 C T 15: 96,362,345 T351I probably benign Het
Asz1 T A 6: 18,075,818 E252V possibly damaging Het
BC024978 C T 7: 27,204,064 probably benign Het
Chrm5 C T 2: 112,479,796 C325Y probably benign Het
Cyp2c65 A G 19: 39,087,674 R357G probably damaging Het
Dhx36 A G 3: 62,495,536 V265A probably damaging Het
Dhx36 T A 3: 62,500,879 E179D probably benign Het
Dip2c G A 13: 9,567,830 probably null Het
Dock10 A T 1: 80,512,531 M1958K probably benign Het
Dpf1 T C 7: 29,316,268 C357R probably damaging Het
Dync1h1 C T 12: 110,658,134 R3703C probably damaging Het
Eef1g A G 19: 8,967,047 probably null Het
Gnl2 T C 4: 125,048,393 V397A probably damaging Het
Gramd3 A G 18: 56,432,336 E21G possibly damaging Het
Grik3 C A 4: 125,623,516 Q51K probably benign Het
Hectd2 G T 19: 36,587,380 Q20H probably damaging Het
Krtap5-1 A G 7: 142,296,496 C192R unknown Het
Lrpap1 A T 5: 35,099,233 M135K probably benign Het
Lrrc9 G A 12: 72,473,936 R664H possibly damaging Het
Mef2c T G 13: 83,652,856 V225G probably damaging Het
Nlrp9b T C 7: 20,019,338 L56P probably damaging Het
Nup133 T C 8: 123,916,281 probably null Het
Odf3 A G 7: 140,848,427 S25G probably benign Het
Olfr533 G A 7: 140,466,735 C178Y probably damaging Het
Olfr993 T A 2: 85,414,604 I92L possibly damaging Het
Ppp1r3d T C 2: 178,413,759 E150G possibly damaging Het
Zbtb46 A G 2: 181,411,836 L361P probably benign Het
Zfp605 A G 5: 110,127,997 H327R probably damaging Het
Other mutations in Smpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Smpd1 APN 7 105556641 missense probably damaging 0.99
IGL01147:Smpd1 APN 7 105555736 missense probably damaging 1.00
IGL01526:Smpd1 APN 7 105554775 missense probably benign 0.01
IGL01541:Smpd1 APN 7 105555826 missense possibly damaging 0.48
IGL01619:Smpd1 APN 7 105555342 missense possibly damaging 0.89
IGL01924:Smpd1 APN 7 105555448 missense probably benign 0.01
IGL03004:Smpd1 APN 7 105556674 missense possibly damaging 0.82
R0782:Smpd1 UTSW 7 105555343 missense possibly damaging 0.80
R1445:Smpd1 UTSW 7 105556674 missense possibly damaging 0.82
R1489:Smpd1 UTSW 7 105556554 unclassified probably null
R3683:Smpd1 UTSW 7 105555402 missense probably damaging 1.00
R3685:Smpd1 UTSW 7 105555402 missense probably damaging 1.00
R3977:Smpd1 UTSW 7 105555901 missense probably benign 0.29
R4850:Smpd1 UTSW 7 105555985 missense probably benign
R5084:Smpd1 UTSW 7 105556978 missense probably damaging 1.00
R6316:Smpd1 UTSW 7 105555502 missense probably benign 0.19
R6429:Smpd1 UTSW 7 105556928 missense probably damaging 1.00
R7156:Smpd1 UTSW 7 105554486 unclassified probably benign
R7883:Smpd1 UTSW 7 105556985 missense probably damaging 1.00
R7966:Smpd1 UTSW 7 105556985 missense probably damaging 1.00
X0021:Smpd1 UTSW 7 105557645 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGAGTAGGTAGCTAGAGGCCTG -3'
(R):5'- TGGCAAAGAGATGTTCCAAGTC -3'

Sequencing Primer
(F):5'- TAGAGGCCTGGTGCTGAAC -3'
(R):5'- GTCGAAAAGATGTCCCAGTGTCC -3'
Posted On2018-07-23