Incidental Mutation 'R6672:Olfr533'
ID527172
Institutional Source Beutler Lab
Gene Symbol Olfr533
Ensembl Gene ENSMUSG00000056883
Gene Nameolfactory receptor 533
SynonymsMOR252-3P, GA_x6K02T2PBJ9-42615403-42616365
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R6672 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location140463370-140468128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 140466735 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 178 (C178Y)
Ref Sequence ENSEMBL: ENSMUSP00000150653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071755] [ENSMUST00000211093] [ENSMUST00000215308] [ENSMUST00000216258] [ENSMUST00000217179]
Predicted Effect probably damaging
Transcript: ENSMUST00000071755
AA Change: C178Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071667
Gene: ENSMUSG00000056883
AA Change: C178Y

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 7.3e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 304 3e-6 PFAM
Pfam:7tm_1 41 289 5.6e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211093
AA Change: C178Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215308
AA Change: C178Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216258
AA Change: C178Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216292
Predicted Effect probably damaging
Transcript: ENSMUST00000217179
AA Change: C178Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7410 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 40,681,533 E680G probably benign Het
Adam7 T A 14: 68,504,702 probably null Het
Arid2 C T 15: 96,362,345 T351I probably benign Het
Asz1 T A 6: 18,075,818 E252V possibly damaging Het
BC024978 C T 7: 27,204,064 probably benign Het
Chrm5 C T 2: 112,479,796 C325Y probably benign Het
Cyp2c65 A G 19: 39,087,674 R357G probably damaging Het
Dhx36 A G 3: 62,495,536 V265A probably damaging Het
Dhx36 T A 3: 62,500,879 E179D probably benign Het
Dip2c G A 13: 9,567,830 probably null Het
Dock10 A T 1: 80,512,531 M1958K probably benign Het
Dpf1 T C 7: 29,316,268 C357R probably damaging Het
Dync1h1 C T 12: 110,658,134 R3703C probably damaging Het
Eef1g A G 19: 8,967,047 probably null Het
Gnl2 T C 4: 125,048,393 V397A probably damaging Het
Gramd3 A G 18: 56,432,336 E21G possibly damaging Het
Grik3 C A 4: 125,623,516 Q51K probably benign Het
Hectd2 G T 19: 36,587,380 Q20H probably damaging Het
Krtap5-1 A G 7: 142,296,496 C192R unknown Het
Lrpap1 A T 5: 35,099,233 M135K probably benign Het
Lrrc9 G A 12: 72,473,936 R664H possibly damaging Het
Mef2c T G 13: 83,652,856 V225G probably damaging Het
Nlrp9b T C 7: 20,019,338 L56P probably damaging Het
Nup133 T C 8: 123,916,281 probably null Het
Odf3 A G 7: 140,848,427 S25G probably benign Het
Olfr993 T A 2: 85,414,604 I92L possibly damaging Het
Ppp1r3d T C 2: 178,413,759 E150G possibly damaging Het
Smpd1 A G 7: 105,555,273 M120V probably benign Het
Zbtb46 A G 2: 181,411,836 L361P probably benign Het
Zfp605 A G 5: 110,127,997 H327R probably damaging Het
Other mutations in Olfr533
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Olfr533 APN 7 140466379 missense probably damaging 0.99
IGL02582:Olfr533 APN 7 140466647 missense probably benign
IGL02954:Olfr533 APN 7 140466440 nonsense probably null
R0790:Olfr533 UTSW 7 140467049 missense possibly damaging 0.79
R1754:Olfr533 UTSW 7 140466860 missense probably damaging 1.00
R1965:Olfr533 UTSW 7 140466661 missense probably benign
R2155:Olfr533 UTSW 7 140466591 missense probably benign 0.13
R4613:Olfr533 UTSW 7 140467068 missense probably damaging 1.00
R4836:Olfr533 UTSW 7 140467076 missense probably damaging 1.00
R5493:Olfr533 UTSW 7 140466807 missense probably damaging 1.00
R5694:Olfr533 UTSW 7 140466731 missense probably benign 0.28
R6101:Olfr533 UTSW 7 140466519 missense probably benign 0.31
R6156:Olfr533 UTSW 7 140466845 missense probably benign
R6519:Olfr533 UTSW 7 140466545 missense probably benign 0.01
R6736:Olfr533 UTSW 7 140466887 missense probably damaging 1.00
R6736:Olfr533 UTSW 7 140466921 missense probably damaging 1.00
R7086:Olfr533 UTSW 7 140466428 missense possibly damaging 0.89
R7174:Olfr533 UTSW 7 140467163 makesense probably null
R7465:Olfr533 UTSW 7 140466798 missense probably damaging 0.99
R7486:Olfr533 UTSW 7 140466034 start gained probably benign
R7872:Olfr533 UTSW 7 140466783 missense probably damaging 1.00
R7955:Olfr533 UTSW 7 140466783 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTGCCATGGCCTATGAC -3'
(R):5'- AAAGTGTGACCACAACCAGG -3'

Sequencing Primer
(F):5'- ATGGCCTATGACCGCTACC -3'
(R):5'- TAGAGAAGGCACGCTTCTTGC -3'
Posted On2018-07-23