Incidental Mutation 'R6672:Odf3'
ID527173
Institutional Source Beutler Lab
Gene Symbol Odf3
Ensembl Gene ENSMUSG00000025482
Gene Nameouter dense fiber of sperm tails 3
Synonyms1700011O04Rik, SHIPPO1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6672 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location140847805-140851018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140848427 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 25 (S25G)
Ref Sequence ENSEMBL: ENSMUSP00000026555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026555] [ENSMUST00000026557] [ENSMUST00000035300] [ENSMUST00000106049] [ENSMUST00000209690]
Predicted Effect probably benign
Transcript: ENSMUST00000026555
AA Change: S25G

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000026555
Gene: ENSMUSG00000025482
AA Change: S25G

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 25 59 3.8e-3 PFAM
Pfam:SHIPPO-rpt 65 95 7.8e-2 PFAM
Pfam:SHIPPO-rpt 100 131 1.2e-7 PFAM
Pfam:SHIPPO-rpt 136 170 3.9e-4 PFAM
Pfam:SHIPPO-rpt 179 209 3e-4 PFAM
Pfam:SHIPPO-rpt 215 245 9.6e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026557
SMART Domains Protein: ENSMUSP00000026557
Gene: ENSMUSG00000025484

DomainStartEndE-ValueType
Pfam:SNARE 20 82 3.4e-13 PFAM
transmembrane domain 87 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035300
SMART Domains Protein: ENSMUSP00000048722
Gene: ENSMUSG00000038801

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
UTG 30 91 1.66e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106049
AA Change: S51G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000101664
Gene: ENSMUSG00000025482
AA Change: S51G

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 126 157 9.4e-6 PFAM
Pfam:SHIPPO-rpt 162 196 1e-3 PFAM
Pfam:SHIPPO-rpt 241 271 7.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190581
Predicted Effect probably benign
Transcript: ENSMUST00000209690
Meta Mutation Damage Score 0.1424 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ODF3 is a component of sperm flagella outer dense fibers, which add stiffness, elastic recoil, and protection against shearing forces during sperm movement.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 40,681,533 E680G probably benign Het
Adam7 T A 14: 68,504,702 probably null Het
Arid2 C T 15: 96,362,345 T351I probably benign Het
Asz1 T A 6: 18,075,818 E252V possibly damaging Het
BC024978 C T 7: 27,204,064 probably benign Het
Chrm5 C T 2: 112,479,796 C325Y probably benign Het
Cyp2c65 A G 19: 39,087,674 R357G probably damaging Het
Dhx36 A G 3: 62,495,536 V265A probably damaging Het
Dhx36 T A 3: 62,500,879 E179D probably benign Het
Dip2c G A 13: 9,567,830 probably null Het
Dock10 A T 1: 80,512,531 M1958K probably benign Het
Dpf1 T C 7: 29,316,268 C357R probably damaging Het
Dync1h1 C T 12: 110,658,134 R3703C probably damaging Het
Eef1g A G 19: 8,967,047 probably null Het
Gnl2 T C 4: 125,048,393 V397A probably damaging Het
Gramd3 A G 18: 56,432,336 E21G possibly damaging Het
Grik3 C A 4: 125,623,516 Q51K probably benign Het
Hectd2 G T 19: 36,587,380 Q20H probably damaging Het
Krtap5-1 A G 7: 142,296,496 C192R unknown Het
Lrpap1 A T 5: 35,099,233 M135K probably benign Het
Lrrc9 G A 12: 72,473,936 R664H possibly damaging Het
Mef2c T G 13: 83,652,856 V225G probably damaging Het
Nlrp9b T C 7: 20,019,338 L56P probably damaging Het
Nup133 T C 8: 123,916,281 probably null Het
Olfr533 G A 7: 140,466,735 C178Y probably damaging Het
Olfr993 T A 2: 85,414,604 I92L possibly damaging Het
Ppp1r3d T C 2: 178,413,759 E150G possibly damaging Het
Smpd1 A G 7: 105,555,273 M120V probably benign Het
Zbtb46 A G 2: 181,411,836 L361P probably benign Het
Zfp605 A G 5: 110,127,997 H327R probably damaging Het
Other mutations in Odf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0051:Odf3 UTSW 7 140850221 unclassified probably benign
R0547:Odf3 UTSW 7 140848815 splice site probably null
R0981:Odf3 UTSW 7 140848295 missense probably benign 0.00
R1221:Odf3 UTSW 7 140848383 missense probably damaging 1.00
R2849:Odf3 UTSW 7 140849269 missense probably benign 0.00
R4833:Odf3 UTSW 7 140848278 start codon destroyed probably null
R4854:Odf3 UTSW 7 140849462 missense probably damaging 1.00
R4896:Odf3 UTSW 7 140848485 intron probably benign
R5109:Odf3 UTSW 7 140849548 missense probably benign 0.11
R6110:Odf3 UTSW 7 140848641 missense possibly damaging 0.73
R6354:Odf3 UTSW 7 140850614 splice site probably null
R6441:Odf3 UTSW 7 140849248 missense probably damaging 1.00
R6516:Odf3 UTSW 7 140848805 missense probably damaging 0.99
R7086:Odf3 UTSW 7 140849489 missense probably benign
R7820:Odf3 UTSW 7 140849263 missense probably benign 0.44
R8069:Odf3 UTSW 7 140850302 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ATCAGCAGTACCAGGGATGG -3'
(R):5'- ATTCTCCGCCAAGAGCATGG -3'

Sequencing Primer
(F):5'- TGGGAACATGAGGGCCAG -3'
(R):5'- AGCCCCACGGAAGCTGTAG -3'
Posted On2018-07-23