Incidental Mutation 'R6672:Krtap5-1'
ID527174
Institutional Source Beutler Lab
Gene Symbol Krtap5-1
Ensembl Gene ENSMUSG00000066100
Gene Namekeratin associated protein 5-1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R6672 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location142296334-142297118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142296496 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 192 (C192R)
Ref Sequence ENSEMBL: ENSMUSP00000139752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084413] [ENSMUST00000188274]
Predicted Effect unknown
Transcript: ENSMUST00000084413
AA Change: C165R
SMART Domains Protein: ENSMUSP00000137356
Gene: ENSMUSG00000066100
AA Change: C165R

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 93 134 3.9e-5 PFAM
Pfam:Keratin_B2_2 112 159 1.8e-7 PFAM
Pfam:Keratin_B2_2 122 170 5e-5 PFAM
Pfam:Keratin_B2_2 150 194 1.3e-8 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000188274
AA Change: C192R
SMART Domains Protein: ENSMUSP00000139752
Gene: ENSMUSG00000066100
AA Change: C192R

DomainStartEndE-ValueType
low complexity region 3 226 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 40,681,533 E680G probably benign Het
Adam7 T A 14: 68,504,702 probably null Het
Arid2 C T 15: 96,362,345 T351I probably benign Het
Asz1 T A 6: 18,075,818 E252V possibly damaging Het
BC024978 C T 7: 27,204,064 probably benign Het
Chrm5 C T 2: 112,479,796 C325Y probably benign Het
Cyp2c65 A G 19: 39,087,674 R357G probably damaging Het
Dhx36 A G 3: 62,495,536 V265A probably damaging Het
Dhx36 T A 3: 62,500,879 E179D probably benign Het
Dip2c G A 13: 9,567,830 probably null Het
Dock10 A T 1: 80,512,531 M1958K probably benign Het
Dpf1 T C 7: 29,316,268 C357R probably damaging Het
Dync1h1 C T 12: 110,658,134 R3703C probably damaging Het
Eef1g A G 19: 8,967,047 probably null Het
Gnl2 T C 4: 125,048,393 V397A probably damaging Het
Gramd3 A G 18: 56,432,336 E21G possibly damaging Het
Grik3 C A 4: 125,623,516 Q51K probably benign Het
Hectd2 G T 19: 36,587,380 Q20H probably damaging Het
Lrpap1 A T 5: 35,099,233 M135K probably benign Het
Lrrc9 G A 12: 72,473,936 R664H possibly damaging Het
Mef2c T G 13: 83,652,856 V225G probably damaging Het
Nlrp9b T C 7: 20,019,338 L56P probably damaging Het
Nup133 T C 8: 123,916,281 probably null Het
Odf3 A G 7: 140,848,427 S25G probably benign Het
Olfr533 G A 7: 140,466,735 C178Y probably damaging Het
Olfr993 T A 2: 85,414,604 I92L possibly damaging Het
Ppp1r3d T C 2: 178,413,759 E150G possibly damaging Het
Smpd1 A G 7: 105,555,273 M120V probably benign Het
Zbtb46 A G 2: 181,411,836 L361P probably benign Het
Zfp605 A G 5: 110,127,997 H327R probably damaging Het
Other mutations in Krtap5-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02799:Krtap5-1 UTSW 7 142296505 nonsense probably null
R0195:Krtap5-1 UTSW 7 142296697 missense unknown
R1903:Krtap5-1 UTSW 7 142296347 unclassified probably benign
R4020:Krtap5-1 UTSW 7 142296357 critical splice acceptor site probably null
R4812:Krtap5-1 UTSW 7 142296891 missense unknown
R5943:Krtap5-1 UTSW 7 142297051 missense unknown
R7203:Krtap5-1 UTSW 7 142296562 missense unknown
R7729:Krtap5-1 UTSW 7 142296596 small deletion probably benign
R7740:Krtap5-1 UTSW 7 142296596 small deletion probably benign
R7840:Krtap5-1 UTSW 7 142296596 small deletion probably benign
R8270:Krtap5-1 UTSW 7 142296462 missense unknown
R8552:Krtap5-1 UTSW 7 142296423 missense probably null
R8788:Krtap5-1 UTSW 7 142296596 small deletion probably benign
R8862:Krtap5-1 UTSW 7 142296596 small deletion probably benign
Z1177:Krtap5-1 UTSW 7 142296960 missense unknown
Predicted Primers PCR Primer
(F):5'- GTCAAGTCGAGAATCTTAAATCTTGCC -3'
(R):5'- CAAACCCTGCTGCTCTTCAG -3'

Sequencing Primer
(F):5'- CGAGAATCTTAAATCTTGCCTTGGC -3'
(R):5'- TCAGTCCAGCTGCTGCAAG -3'
Posted On2018-07-23