Incidental Mutation 'R6672:Adam24'
ID527175
Institutional Source Beutler Lab
Gene Symbol Adam24
Ensembl Gene ENSMUSG00000046723
Gene Namea disintegrin and metallopeptidase domain 24 (testase 1)
SynonymsDtgn5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6672 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location40675077-40682199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40681533 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 680 (E680G)
Ref Sequence ENSEMBL: ENSMUSP00000050727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051614]
Predicted Effect probably benign
Transcript: ENSMUST00000051614
AA Change: E680G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000050727
Gene: ENSMUSG00000046723
AA Change: E680G

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 160 3.3e-14 PFAM
Pfam:Reprolysin_2 193 389 6.3e-13 PFAM
Pfam:Reprolysin 208 398 7.8e-43 PFAM
Pfam:Reprolysin_5 209 382 3e-17 PFAM
Pfam:Reprolysin_4 209 392 4.9e-13 PFAM
Pfam:Reprolysin_3 232 353 9.9e-16 PFAM
DISIN 415 491 7.13e-39 SMART
ACR 492 628 7.74e-69 SMART
transmembrane domain 698 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210267
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. Male mice lacking the encoded protein exhibit reduced fertility due to the higher incidence of polyspermic embryos. This gene is located adjacent to other ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
PHENOTYPE: Males homozygous for a targeted null mutation are subfertile and produce an increased number of polyspermic embryos at the pronuclear stage. Female homozygotes show normal fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam7 T A 14: 68,504,702 probably null Het
Arid2 C T 15: 96,362,345 T351I probably benign Het
Asz1 T A 6: 18,075,818 E252V possibly damaging Het
BC024978 C T 7: 27,204,064 probably benign Het
Chrm5 C T 2: 112,479,796 C325Y probably benign Het
Cyp2c65 A G 19: 39,087,674 R357G probably damaging Het
Dhx36 A G 3: 62,495,536 V265A probably damaging Het
Dhx36 T A 3: 62,500,879 E179D probably benign Het
Dip2c G A 13: 9,567,830 probably null Het
Dock10 A T 1: 80,512,531 M1958K probably benign Het
Dpf1 T C 7: 29,316,268 C357R probably damaging Het
Dync1h1 C T 12: 110,658,134 R3703C probably damaging Het
Eef1g A G 19: 8,967,047 probably null Het
Gnl2 T C 4: 125,048,393 V397A probably damaging Het
Gramd3 A G 18: 56,432,336 E21G possibly damaging Het
Grik3 C A 4: 125,623,516 Q51K probably benign Het
Hectd2 G T 19: 36,587,380 Q20H probably damaging Het
Krtap5-1 A G 7: 142,296,496 C192R unknown Het
Lrpap1 A T 5: 35,099,233 M135K probably benign Het
Lrrc9 G A 12: 72,473,936 R664H possibly damaging Het
Mef2c T G 13: 83,652,856 V225G probably damaging Het
Nlrp9b T C 7: 20,019,338 L56P probably damaging Het
Nup133 T C 8: 123,916,281 probably null Het
Odf3 A G 7: 140,848,427 S25G probably benign Het
Olfr533 G A 7: 140,466,735 C178Y probably damaging Het
Olfr993 T A 2: 85,414,604 I92L possibly damaging Het
Ppp1r3d T C 2: 178,413,759 E150G possibly damaging Het
Smpd1 A G 7: 105,555,273 M120V probably benign Het
Zbtb46 A G 2: 181,411,836 L361P probably benign Het
Zfp605 A G 5: 110,127,997 H327R probably damaging Het
Other mutations in Adam24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02479:Adam24 APN 8 40679532 missense probably benign 0.41
IGL02517:Adam24 APN 8 40680179 missense probably damaging 1.00
R0195:Adam24 UTSW 8 40681766 missense probably benign 0.00
R1067:Adam24 UTSW 8 40680754 nonsense probably null
R1180:Adam24 UTSW 8 40681428 missense probably damaging 1.00
R1438:Adam24 UTSW 8 40681392 missense probably benign 0.19
R1741:Adam24 UTSW 8 40679603 missense probably benign 0.00
R1779:Adam24 UTSW 8 40680965 missense possibly damaging 0.83
R1940:Adam24 UTSW 8 40681361 nonsense probably null
R2228:Adam24 UTSW 8 40680365 missense probably benign 0.00
R2229:Adam24 UTSW 8 40680365 missense probably benign 0.00
R2265:Adam24 UTSW 8 40680071 missense possibly damaging 0.95
R2359:Adam24 UTSW 8 40680945 missense possibly damaging 0.91
R3551:Adam24 UTSW 8 40679593 missense probably benign 0.03
R3837:Adam24 UTSW 8 40680545 missense probably benign
R4834:Adam24 UTSW 8 40679699 missense probably damaging 1.00
R5121:Adam24 UTSW 8 40679511 missense probably damaging 1.00
R5410:Adam24 UTSW 8 40681064 missense probably benign 0.01
R5787:Adam24 UTSW 8 40680902 missense possibly damaging 0.87
R5900:Adam24 UTSW 8 40681032 missense probably benign 0.00
R6600:Adam24 UTSW 8 40680548 missense probably damaging 1.00
R6633:Adam24 UTSW 8 40680487 missense probably benign 0.12
R6904:Adam24 UTSW 8 40681503 missense probably damaging 1.00
R7178:Adam24 UTSW 8 40680000 nonsense probably null
R7542:Adam24 UTSW 8 40680809 missense possibly damaging 0.46
R7578:Adam24 UTSW 8 40680255 missense probably benign 0.01
R7708:Adam24 UTSW 8 40680519 missense probably damaging 1.00
R8739:Adam24 UTSW 8 40680441 missense possibly damaging 0.68
R8823:Adam24 UTSW 8 40680189 missense probably benign 0.01
X0010:Adam24 UTSW 8 40680015 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTGTGCATTGCCAGAAAGTG -3'
(R):5'- CTGTCTCATATGAGGGTTCAGC -3'

Sequencing Primer
(F):5'- TGCCAGAAAGTGTGTTAATAAGCC -3'
(R):5'- CAGCCCCTTCATATGGTGG -3'
Posted On2018-07-23