Mutagenetix > Incidental Mutation

Incidental Mutation 'R6672:Lrrc9'

527176

Institutional Source

Beutler Lab

Gene Symbol

Lrrc9

Ensembl Gene

ENSMUSG00000021090

Gene Name

leucine rich repeat containing 9

Synonyms

4930432K16Rik, 4921529O18Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.228) question?

Stock #

R6672 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

72441866-72530750 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 72473936 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 664 (R664H)

Ref Sequence

ENSEMBL: ENSMUSP00000152125 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000161284] [ENSMUST00000162159] [ENSMUST00000221360]

AlphaFold

Q8CDN9

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161195

Predicted Effect

probably benign
Transcript: ENSMUST00000161284
AA Change: R664H

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000124602
Gene: ENSMUSG00000021090
AA Change: R664H

Domain	Start	End	E-Value	Type
Pfam:LRR_4	77	118	2.8e-11	PFAM
LRR	119	140	8.49e1	SMART
LRR	141	164	2.27e1	SMART
LRR	165	187	2.09e2	SMART
LRRcap	210	228	6.12e1	SMART
low complexity region	373	384	N/A	INTRINSIC
low complexity region	424	436	N/A	INTRINSIC
LRR	706	727	1.41e2	SMART
LRR	728	749	6.78e1	SMART
LRR	750	773	7.17e1	SMART
LRRcap	793	811	2.26e2	SMART
LRR	943	966	2.67e-1	SMART
LRR	967	992	1.22e1	SMART
LRRcap	1031	1049	4.37e0	SMART
low complexity region	1109	1120	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161547

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161957

Predicted Effect

probably benign
Transcript: ENSMUST00000162159
AA Change: R663H

PolyPhen 2 Score 0.340 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000124394
Gene: ENSMUSG00000021090
AA Change: R663H

Domain	Start	End	E-Value	Type
LRR	53	74	5.39e2	SMART
LRR	75	96	1.14e2	SMART
LRR	97	118	7.9e-4	SMART
LRR	119	140	2.75e-3	SMART
LRR	141	164	2.27e1	SMART
LRR	164	185	1.87e1	SMART
LRRcap	210	228	6.12e1	SMART
low complexity region	373	384	N/A	INTRINSIC
low complexity region	424	436	N/A	INTRINSIC
LRR	705	726	1.41e2	SMART
LRR	727	748	6.78e1	SMART
LRR	749	771	1.37e1	SMART
LRRcap	792	810	2.26e2	SMART
LRR	898	919	2.62e1	SMART
LRR	920	941	5.17e1	SMART
LRR	942	965	2.67e-1	SMART
LRR	966	991	1.22e1	SMART
LRR	1013	1032	4.42e2	SMART
LRRcap	1030	1048	4.37e0	SMART
low complexity region	1108	1119	N/A	INTRINSIC
LRR	1128	1150	2.4e1	SMART
LRR	1191	1209	5.7e2	SMART
LRR	1215	1236	1.03e-2	SMART
LRR	1237	1260	8.48e0	SMART
LRR	1283	1304	2.67e-1	SMART
Blast:LRR	1308	1333	4e-6	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196758

Predicted Effect

possibly damaging
Transcript: ENSMUST00000221360
AA Change: R664H

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

100% (31/31)

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam24	A	G	8: 40,681,533	E680G	probably benign	Het
Adam7	T	A	14: 68,504,702		probably null	Het
Arid2	C	T	15: 96,362,345	T351I	probably benign	Het
Asz1	T	A	6: 18,075,818	E252V	possibly damaging	Het
BC024978	C	T	7: 27,204,064		probably benign	Het
Chrm5	C	T	2: 112,479,796	C325Y	probably benign	Het
Cyp2c65	A	G	19: 39,087,674	R357G	probably damaging	Het
Dhx36	A	G	3: 62,495,536	V265A	probably damaging	Het
Dhx36	T	A	3: 62,500,879	E179D	probably benign	Het
Dip2c	G	A	13: 9,567,830		probably null	Het
Dock10	A	T	1: 80,512,531	M1958K	probably benign	Het
Dpf1	T	C	7: 29,316,268	C357R	probably damaging	Het
Dync1h1	C	T	12: 110,658,134	R3703C	probably damaging	Het
Eef1g	A	G	19: 8,967,047		probably null	Het
Gnl2	T	C	4: 125,048,393	V397A	probably damaging	Het
Gramd3	A	G	18: 56,432,336	E21G	possibly damaging	Het
Grik3	C	A	4: 125,623,516	Q51K	probably benign	Het
Hectd2	G	T	19: 36,587,380	Q20H	probably damaging	Het
Krtap5-1	A	G	7: 142,296,496	C192R	unknown	Het
Lrpap1	A	T	5: 35,099,233	M135K	probably benign	Het
Mef2c	T	G	13: 83,652,856	V225G	probably damaging	Het
Nlrp9b	T	C	7: 20,019,338	L56P	probably damaging	Het
Nup133	T	C	8: 123,916,281		probably null	Het
Odf3	A	G	7: 140,848,427	S25G	probably benign	Het
Olfr533	G	A	7: 140,466,735	C178Y	probably damaging	Het
Olfr993	T	A	2: 85,414,604	I92L	possibly damaging	Het
Ppp1r3d	T	C	2: 178,413,759	E150G	possibly damaging	Het
Smpd1	A	G	7: 105,555,273	M120V	probably benign	Het
Zbtb46	A	G	2: 181,411,836	L361P	probably benign	Het
Zfp605	A	G	5: 110,127,997	H327R	probably damaging	Het

Other mutations in Lrrc9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Lrrc9	APN	12	72486243	missense	possibly damaging	0.63
IGL00843:Lrrc9	APN	12	72463417	missense	possibly damaging	0.78
IGL01923:Lrrc9	APN	12	72510412	missense	possibly damaging	0.93
IGL02027:Lrrc9	APN	12	72470334	splice site	probably benign
IGL02271:Lrrc9	APN	12	72510381	missense	probably benign	0.06
IGL02398:Lrrc9	APN	12	72466903	missense	probably benign
IGL02795:Lrrc9	APN	12	72478768	missense	probably damaging	1.00
IGL02931:Lrrc9	APN	12	72454149	missense	probably damaging	1.00
IGL03257:Lrrc9	APN	12	72449768	missense	probably benign
BB006:Lrrc9	UTSW	12	72486297	missense	possibly damaging	0.92
BB016:Lrrc9	UTSW	12	72486297	missense	possibly damaging	0.92
IGL02799:Lrrc9	UTSW	12	72506404	missense	probably damaging	1.00
R0172:Lrrc9	UTSW	12	72463486	missense	possibly damaging	0.50
R0315:Lrrc9	UTSW	12	72456028	missense	probably damaging	0.96
R0492:Lrrc9	UTSW	12	72478763	missense	possibly damaging	0.47
R0617:Lrrc9	UTSW	12	72483014	missense	probably damaging	1.00
R0639:Lrrc9	UTSW	12	72486288	missense	probably damaging	1.00
R0987:Lrrc9	UTSW	12	72510382	missense	probably benign	0.00
R1325:Lrrc9	UTSW	12	72497104	missense	probably damaging	0.99
R1465:Lrrc9	UTSW	12	72500759	missense	probably benign	0.05
R1465:Lrrc9	UTSW	12	72500759	missense	probably benign	0.05
R1479:Lrrc9	UTSW	12	72460825	nonsense	probably null
R1564:Lrrc9	UTSW	12	72487053	missense	probably damaging	1.00
R1626:Lrrc9	UTSW	12	72495661	splice site	probably null
R1632:Lrrc9	UTSW	12	72460020	splice site	probably null
R1715:Lrrc9	UTSW	12	72477299	missense	probably damaging	1.00
R1743:Lrrc9	UTSW	12	72456117	missense	probably damaging	1.00
R1779:Lrrc9	UTSW	12	72455998	nonsense	probably null
R1866:Lrrc9	UTSW	12	72497138	missense	probably damaging	0.97
R1878:Lrrc9	UTSW	12	72476164	critical splice donor site	probably null
R1990:Lrrc9	UTSW	12	72497861	missense	probably damaging	0.99
R2361:Lrrc9	UTSW	12	72463470	missense	possibly damaging	0.52
R3752:Lrrc9	UTSW	12	72460806	nonsense	probably null
R3833:Lrrc9	UTSW	12	72482991	missense	probably damaging	1.00
R4134:Lrrc9	UTSW	12	72466966	missense	probably benign	0.00
R4651:Lrrc9	UTSW	12	72477386	missense	probably damaging	1.00
R4652:Lrrc9	UTSW	12	72477386	missense	probably damaging	1.00
R4659:Lrrc9	UTSW	12	72470264	missense	probably damaging	1.00
R4831:Lrrc9	UTSW	12	72499679	missense	probably damaging	1.00
R4857:Lrrc9	UTSW	12	72499692	missense	possibly damaging	0.94
R5017:Lrrc9	UTSW	12	72506325	missense	possibly damaging	0.86
R5163:Lrrc9	UTSW	12	72449389	missense	probably damaging	1.00
R5279:Lrrc9	UTSW	12	72495594	missense	possibly damaging	0.80
R5434:Lrrc9	UTSW	12	72454088	missense	probably damaging	0.98
R5783:Lrrc9	UTSW	12	72456053	missense	possibly damaging	0.62
R6021:Lrrc9	UTSW	12	72469231	missense	probably damaging	0.97
R6214:Lrrc9	UTSW	12	72459853	missense	probably damaging	1.00
R6255:Lrrc9	UTSW	12	72487023	missense	probably benign	0.33
R6538:Lrrc9	UTSW	12	72500929	missense	probably benign	0.08
R6563:Lrrc9	UTSW	12	72486395	splice site	probably null
R6919:Lrrc9	UTSW	12	72506393	missense	probably benign	0.01
R6929:Lrrc9	UTSW	12	72450772	missense	probably benign	0.41
R7092:Lrrc9	UTSW	12	72463464	missense	possibly damaging	0.81
R7150:Lrrc9	UTSW	12	72466952	missense	probably benign	0.00
R7338:Lrrc9	UTSW	12	72463531	splice site	probably null
R7398:Lrrc9	UTSW	12	72500816	missense	probably damaging	0.98
R7477:Lrrc9	UTSW	12	72503527	critical splice donor site	probably null
R7501:Lrrc9	UTSW	12	72449716	missense	probably damaging	1.00
R7542:Lrrc9	UTSW	12	72506320	missense	probably damaging	0.96
R7816:Lrrc9	UTSW	12	72495692	missense	probably damaging	1.00
R7870:Lrrc9	UTSW	12	72486190	missense	probably damaging	0.99
R7929:Lrrc9	UTSW	12	72486297	missense	possibly damaging	0.92
R8042:Lrrc9	UTSW	12	72460906	missense	probably benign	0.02
R8108:Lrrc9	UTSW	12	72454059	missense	probably damaging	1.00
R8192:Lrrc9	UTSW	12	72449389	missense	probably damaging	1.00
R8244:Lrrc9	UTSW	12	72499610	missense	probably benign	0.22
R8333:Lrrc9	UTSW	12	72481543	missense	probably benign	0.38
R9288:Lrrc9	UTSW	12	72476084	missense	probably benign	0.01
R9324:Lrrc9	UTSW	12	72449397	missense	probably damaging	1.00
R9342:Lrrc9	UTSW	12	72459993	missense	probably damaging	1.00
R9557:Lrrc9	UTSW	12	72486207	missense	probably benign	0.01
R9624:Lrrc9	UTSW	12	72450812	missense	probably benign	0.19
R9677:Lrrc9	UTSW	12	72450765	missense	probably damaging	1.00
X0025:Lrrc9	UTSW	12	72497060	missense	probably damaging	1.00
Z1176:Lrrc9	UTSW	12	72477393	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCATGCCTAGCTCACAGTC -3'
(R):5'- GAGGACTGGAGACTTTGCAATC -3'

Sequencing Primer
(F):5'- GCCTAGCTCACAGTCTTAATCTATG -3'
(R):5'- CAAATTCAGGATTGCCTTCC -3'

Posted On

2018-07-23