Mutagenetix > Incidental Mutation

Incidental Mutation 'R6672:Arid2'

527181

Institutional Source

Beutler Lab

Gene Symbol

Arid2

Ensembl Gene

ENSMUSG00000033237

Gene Name

AT rich interactive domain 2 (ARID, RFX-like)

Synonyms

4432409D24Rik, 1700124K17Rik, zipzap/p200

MMRRC Submission

044792-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6672 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

96287518-96404992 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 96362345 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 351 (T351I)

Ref Sequence

ENSEMBL: ENSMUSP00000093969 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096250]

AlphaFold

E9Q7E2

Predicted Effect

probably benign
Transcript: ENSMUST00000096250
AA Change: T351I

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000093969
Gene: ENSMUSG00000033237
AA Change: T351I

Domain	Start	End	E-Value	Type
ARID	10	101	9.67e-36	SMART
BRIGHT	14	106	3.67e-34	SMART
Pfam:RFX_DNA_binding	521	603	1.7e-26	PFAM
internal_repeat_1	767	843	3.29e-6	PROSPERO
low complexity region	902	942	N/A	INTRINSIC
low complexity region	965	986	N/A	INTRINSIC
low complexity region	1012	1054	N/A	INTRINSIC
low complexity region	1118	1131	N/A	INTRINSIC
internal_repeat_1	1132	1215	3.29e-6	PROSPERO
low complexity region	1453	1468	N/A	INTRINSIC
low complexity region	1590	1614	N/A	INTRINSIC
ZnF_C2H2	1626	1651	4.34e0	SMART
ZnF_C2H2	1659	1684	4.74e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175735

Meta Mutation Damage Score

0.1478

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

100% (31/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interactive domain (ARID)-containing family of DNA-binding proteins. Members of the ARID family have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation and chromatin structure modification. This protein functions as a subunit of the polybromo- and BRG1-associated factor or PBAF (SWI/SNF-B) chromatin remodeling complex which facilitates ligand-dependent transcriptional activation by nuclear receptors. Mutations in this gene are associated with hepatocellular carcinomas. A pseudogene of this gene is found on chromosome1. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E12.5 and E14.5, congenital heart defects, impaired coronary artery development, subcutaneous edema and hemorrhage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam24	A	G	8: 40,681,533	E680G	probably benign	Het
Adam7	T	A	14: 68,504,702		probably null	Het
Asz1	T	A	6: 18,075,818	E252V	possibly damaging	Het
BC024978	C	T	7: 27,204,064		probably benign	Het
Chrm5	C	T	2: 112,479,796	C325Y	probably benign	Het
Cyp2c65	A	G	19: 39,087,674	R357G	probably damaging	Het
Dhx36	A	G	3: 62,495,536	V265A	probably damaging	Het
Dhx36	T	A	3: 62,500,879	E179D	probably benign	Het
Dip2c	G	A	13: 9,567,830		probably null	Het
Dock10	A	T	1: 80,512,531	M1958K	probably benign	Het
Dpf1	T	C	7: 29,316,268	C357R	probably damaging	Het
Dync1h1	C	T	12: 110,658,134	R3703C	probably damaging	Het
Eef1g	A	G	19: 8,967,047		probably null	Het
Gnl2	T	C	4: 125,048,393	V397A	probably damaging	Het
Gramd3	A	G	18: 56,432,336	E21G	possibly damaging	Het
Grik3	C	A	4: 125,623,516	Q51K	probably benign	Het
Hectd2	G	T	19: 36,587,380	Q20H	probably damaging	Het
Krtap5-1	A	G	7: 142,296,496	C192R	unknown	Het
Lrpap1	A	T	5: 35,099,233	M135K	probably benign	Het
Lrrc9	G	A	12: 72,473,936	R664H	possibly damaging	Het
Mef2c	T	G	13: 83,652,856	V225G	probably damaging	Het
Nlrp9b	T	C	7: 20,019,338	L56P	probably damaging	Het
Nup133	T	C	8: 123,916,281		probably null	Het
Odf3	A	G	7: 140,848,427	S25G	probably benign	Het
Olfr533	G	A	7: 140,466,735	C178Y	probably damaging	Het
Olfr993	T	A	2: 85,414,604	I92L	possibly damaging	Het
Ppp1r3d	T	C	2: 178,413,759	E150G	possibly damaging	Het
Smpd1	A	G	7: 105,555,273	M120V	probably benign	Het
Zbtb46	A	G	2: 181,411,836	L361P	probably benign	Het
Zfp605	A	G	5: 110,127,997	H327R	probably damaging	Het

Other mutations in Arid2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Arid2	APN	15	96372302	missense	probably benign
IGL00321:Arid2	APN	15	96289089	missense	probably damaging	0.97
IGL00434:Arid2	APN	15	96371300	missense	probably damaging	0.99
IGL00576:Arid2	APN	15	96356758	missense	probably damaging	0.99
IGL00766:Arid2	APN	15	96370405	missense	probably benign	0.09
IGL01563:Arid2	APN	15	96372397	missense	probably damaging	0.99
IGL01697:Arid2	APN	15	96361572	critical splice acceptor site	probably null
IGL01845:Arid2	APN	15	96356797	missense	probably damaging	1.00
IGL02159:Arid2	APN	15	96358912	splice site	probably benign
IGL02341:Arid2	APN	15	96372185	missense	probably benign
IGL02416:Arid2	APN	15	96350055	missense	possibly damaging	0.63
IGL02578:Arid2	APN	15	96372235	missense	probably benign	0.00
IGL02598:Arid2	APN	15	96371536	missense	probably damaging	1.00
IGL02644:Arid2	APN	15	96368708	missense	probably damaging	1.00
IGL02653:Arid2	APN	15	96287702	missense	probably damaging	0.99
IGL03115:Arid2	APN	15	96370273	missense	probably damaging	1.00
IGL03137:Arid2	APN	15	96371318	missense	probably benign	0.44
IGL03220:Arid2	APN	15	96361772	missense	probably damaging	0.99
IGL03249:Arid2	APN	15	96401965	missense	probably damaging	1.00
IGL03256:Arid2	APN	15	96370762	missense	probably benign	0.18
IGL03386:Arid2	APN	15	96361574	missense	probably damaging	1.00
H8562:Arid2	UTSW	15	96369546	missense	possibly damaging	0.77
I2288:Arid2	UTSW	15	96369511	missense	possibly damaging	0.95
R0254:Arid2	UTSW	15	96370571	missense	probably damaging	0.97
R0284:Arid2	UTSW	15	96378967	splice site	probably benign
R0347:Arid2	UTSW	15	96370952	missense	probably benign	0.01
R0366:Arid2	UTSW	15	96361720	splice site	probably benign
R0400:Arid2	UTSW	15	96356925	unclassified	probably benign
R0650:Arid2	UTSW	15	96402049	missense	possibly damaging	0.47
R0651:Arid2	UTSW	15	96402049	missense	possibly damaging	0.47
R1034:Arid2	UTSW	15	96369505	missense	probably benign	0.01
R1615:Arid2	UTSW	15	96371654	missense	possibly damaging	0.59
R1696:Arid2	UTSW	15	96370183	missense	probably benign	0.01
R2024:Arid2	UTSW	15	96361799	missense	probably damaging	1.00
R2046:Arid2	UTSW	15	96369387	missense	probably damaging	1.00
R2069:Arid2	UTSW	15	96362590	missense	probably damaging	1.00
R2149:Arid2	UTSW	15	96370835	missense	probably damaging	1.00
R2300:Arid2	UTSW	15	96402006	missense	probably damaging	1.00
R2336:Arid2	UTSW	15	96362549	missense	probably damaging	1.00
R2359:Arid2	UTSW	15	96361878	missense	probably damaging	1.00
R2368:Arid2	UTSW	15	96350012	missense	possibly damaging	0.83
R2829:Arid2	UTSW	15	96369454	missense	possibly damaging	0.95
R3013:Arid2	UTSW	15	96361936	missense	probably damaging	1.00
R3109:Arid2	UTSW	15	96356746	missense	probably damaging	1.00
R3765:Arid2	UTSW	15	96370714	missense	probably benign	0.01
R3785:Arid2	UTSW	15	96372558	missense	possibly damaging	0.83
R3811:Arid2	UTSW	15	96289086	missense	probably benign	0.01
R3812:Arid2	UTSW	15	96289086	missense	probably benign	0.01
R3813:Arid2	UTSW	15	96369950	missense	probably benign	0.26
R3843:Arid2	UTSW	15	96351840	missense	possibly damaging	0.86
R3978:Arid2	UTSW	15	96363622	missense	probably damaging	1.00
R4279:Arid2	UTSW	15	96371756	missense	probably damaging	1.00
R4569:Arid2	UTSW	15	96392462	missense	probably damaging	1.00
R4597:Arid2	UTSW	15	96370856	missense	probably damaging	1.00
R5020:Arid2	UTSW	15	96371988	missense	probably damaging	0.96
R5154:Arid2	UTSW	15	96401985	missense	probably damaging	1.00
R5303:Arid2	UTSW	15	96392468	missense	probably damaging	1.00
R5620:Arid2	UTSW	15	96372506	missense	probably benign	0.20
R5766:Arid2	UTSW	15	96372205	missense	probably benign	0.01
R6005:Arid2	UTSW	15	96370972	missense	probably benign
R6169:Arid2	UTSW	15	96368677	missense	probably benign	0.36
R6216:Arid2	UTSW	15	96356909	missense	probably benign	0.18
R6392:Arid2	UTSW	15	96361602	missense	probably damaging	0.99
R6430:Arid2	UTSW	15	96363694	missense	probably benign
R6454:Arid2	UTSW	15	96372413	missense	probably benign	0.20
R6776:Arid2	UTSW	15	96370949	missense	probably benign	0.00
R6985:Arid2	UTSW	15	96370148	missense	probably benign	0.06
R7132:Arid2	UTSW	15	96350013	missense	possibly damaging	0.67
R7133:Arid2	UTSW	15	96378875	missense	probably damaging	0.99
R7453:Arid2	UTSW	15	96370724	missense	probably benign
R7562:Arid2	UTSW	15	96401968	missense	probably damaging	1.00
R7594:Arid2	UTSW	15	96390994	missense	probably damaging	1.00
R7692:Arid2	UTSW	15	96356697	nonsense	probably null
R7792:Arid2	UTSW	15	96369375	missense	probably benign	0.05
R8036:Arid2	UTSW	15	96368744	missense	probably damaging	1.00
R8094:Arid2	UTSW	15	96368711	missense	possibly damaging	0.86
R8327:Arid2	UTSW	15	96362604	missense	probably damaging	1.00
R9065:Arid2	UTSW	15	96371491	missense	probably benign	0.44
R9143:Arid2	UTSW	15	96361834	missense	probably damaging	0.99
R9320:Arid2	UTSW	15	96371186	missense	probably damaging	1.00
R9346:Arid2	UTSW	15	96287911	missense	probably benign	0.01
R9519:Arid2	UTSW	15	96289067	missense	possibly damaging	0.46
R9651:Arid2	UTSW	15	96358941	missense	probably benign	0.44
X0024:Arid2	UTSW	15	96372490	missense	probably benign	0.00
X0066:Arid2	UTSW	15	96356804	missense	probably damaging	1.00
Z1177:Arid2	UTSW	15	96390986	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATGATACTTGAAGTTCGGTGGTAAC -3'
(R):5'- AGCATGTACAGCACCTCCAG -3'

Sequencing Primer
(F):5'- AAGTTCGGTGGTAACTGATCCCAG -3'
(R):5'- CAGAGTGAGGTGACAAATTATCTCTC -3'

Posted On

2018-07-23