Incidental Mutation 'R6672:Gramd3'
ID527182
Institutional Source Beutler Lab
Gene Symbol Gramd3
Ensembl Gene ENSMUSG00000001700
Gene NameGRAM domain containing 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6672 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location56432132-56503792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56432336 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 21 (E21G)
Ref Sequence ENSEMBL: ENSMUSP00000068453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070166]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070166
AA Change: E21G

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000068453
Gene: ENSMUSG00000001700
AA Change: E21G

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
low complexity region 86 104 N/A INTRINSIC
GRAM 110 177 3.06e-23 SMART
transmembrane domain 342 364 N/A INTRINSIC
coiled coil region 404 430 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 40,681,533 E680G probably benign Het
Adam7 T A 14: 68,504,702 probably null Het
Arid2 C T 15: 96,362,345 T351I probably benign Het
Asz1 T A 6: 18,075,818 E252V possibly damaging Het
BC024978 C T 7: 27,204,064 probably benign Het
Chrm5 C T 2: 112,479,796 C325Y probably benign Het
Cyp2c65 A G 19: 39,087,674 R357G probably damaging Het
Dhx36 A G 3: 62,495,536 V265A probably damaging Het
Dhx36 T A 3: 62,500,879 E179D probably benign Het
Dip2c G A 13: 9,567,830 probably null Het
Dock10 A T 1: 80,512,531 M1958K probably benign Het
Dpf1 T C 7: 29,316,268 C357R probably damaging Het
Dync1h1 C T 12: 110,658,134 R3703C probably damaging Het
Eef1g A G 19: 8,967,047 probably null Het
Gnl2 T C 4: 125,048,393 V397A probably damaging Het
Grik3 C A 4: 125,623,516 Q51K probably benign Het
Hectd2 G T 19: 36,587,380 Q20H probably damaging Het
Krtap5-1 A G 7: 142,296,496 C192R unknown Het
Lrpap1 A T 5: 35,099,233 M135K probably benign Het
Lrrc9 G A 12: 72,473,936 R664H possibly damaging Het
Mef2c T G 13: 83,652,856 V225G probably damaging Het
Nlrp9b T C 7: 20,019,338 L56P probably damaging Het
Nup133 T C 8: 123,916,281 probably null Het
Odf3 A G 7: 140,848,427 S25G probably benign Het
Olfr533 G A 7: 140,466,735 C178Y probably damaging Het
Olfr993 T A 2: 85,414,604 I92L possibly damaging Het
Ppp1r3d T C 2: 178,413,759 E150G possibly damaging Het
Smpd1 A G 7: 105,555,273 M120V probably benign Het
Zbtb46 A G 2: 181,411,836 L361P probably benign Het
Zfp605 A G 5: 110,127,997 H327R probably damaging Het
Other mutations in Gramd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01582:Gramd3 APN 18 56485416 missense probably damaging 0.99
IGL01903:Gramd3 APN 18 56474029 missense probably damaging 0.99
IGL02203:Gramd3 APN 18 56478954 critical splice donor site probably null
IGL03210:Gramd3 APN 18 56474098 missense probably benign
PIT4283001:Gramd3 UTSW 18 56489663 missense probably damaging 1.00
R0432:Gramd3 UTSW 18 56474069 missense probably benign 0.00
R1623:Gramd3 UTSW 18 56432351 missense probably benign 0.00
R4019:Gramd3 UTSW 18 56478954 critical splice donor site probably null
R4125:Gramd3 UTSW 18 56485224 missense probably damaging 1.00
R4750:Gramd3 UTSW 18 56432300 missense probably benign 0.44
R4927:Gramd3 UTSW 18 56485451 missense probably damaging 0.96
R5495:Gramd3 UTSW 18 56482622 missense probably damaging 1.00
R5866:Gramd3 UTSW 18 56474036 missense possibly damaging 0.93
R6443:Gramd3 UTSW 18 56485385 missense probably benign 0.00
R7030:Gramd3 UTSW 18 56485249 missense probably damaging 1.00
R7099:Gramd3 UTSW 18 56491945 missense probably benign 0.01
R7162:Gramd3 UTSW 18 56485457 critical splice donor site probably null
R7854:Gramd3 UTSW 18 56478854 missense probably damaging 1.00
R7975:Gramd3 UTSW 18 56485379 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGGCTGTCACTTTGCTTC -3'
(R):5'- ATGCATTCTTCGGTGAGGAGAG -3'

Sequencing Primer
(F):5'- AACGTGTCCATGTTGGCG -3'
(R):5'- GGATACATGGACACACACGGAC -3'
Posted On2018-07-23