Incidental Mutation 'R6672:Eef1g'
ID527183
Institutional Source Beutler Lab
Gene Symbol Eef1g
Ensembl Gene ENSMUSG00000071644
Gene Nameeukaryotic translation elongation factor 1 gamma
SynonymsEF1G, 2610301D06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R6672 (G1)
Quality Score93.0077
Status Validated
Chromosome19
Chromosomal Location8967041-8978479 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 8967047 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052248] [ENSMUST00000096239]
Predicted Effect probably null
Transcript: ENSMUST00000052248
SMART Domains Protein: ENSMUSP00000093955
Gene: ENSMUSG00000071644

DomainStartEndE-ValueType
Pfam:GST_N 2 81 1.5e-25 PFAM
Pfam:GST_N_3 6 83 1.4e-8 PFAM
Pfam:GST_C_3 88 194 8.3e-13 PFAM
Pfam:GST_C 106 198 4.5e-22 PFAM
Pfam:GST_C_2 125 191 8.6e-12 PFAM
low complexity region 238 262 N/A INTRINSIC
EF1G 275 381 3.63e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096239
SMART Domains Protein: ENSMUSP00000093958
Gene: ENSMUSG00000071645

DomainStartEndE-ValueType
ZnF_C2H2 16 40 1.53e-1 SMART
RRM 57 124 2.02e-10 SMART
SCOP:d1f5aa2 173 221 1e-3 SMART
low complexity region 242 258 N/A INTRINSIC
low complexity region 300 314 N/A INTRINSIC
low complexity region 324 347 N/A INTRINSIC
low complexity region 423 434 N/A INTRINSIC
Pfam:PAP_assoc 493 552 2.7e-8 PFAM
low complexity region 594 618 N/A INTRINSIC
low complexity region 767 782 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152076
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This subunit contains an N-terminal glutathione transferase domain, which may be involved in regulating the assembly of multisubunit complexes containing this elongation factor and aminoacyl-tRNA synthetases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 40,681,533 E680G probably benign Het
Adam7 T A 14: 68,504,702 probably null Het
Arid2 C T 15: 96,362,345 T351I probably benign Het
Asz1 T A 6: 18,075,818 E252V possibly damaging Het
BC024978 C T 7: 27,204,064 probably benign Het
Chrm5 C T 2: 112,479,796 C325Y probably benign Het
Cyp2c65 A G 19: 39,087,674 R357G probably damaging Het
Dhx36 A G 3: 62,495,536 V265A probably damaging Het
Dhx36 T A 3: 62,500,879 E179D probably benign Het
Dip2c G A 13: 9,567,830 probably null Het
Dock10 A T 1: 80,512,531 M1958K probably benign Het
Dpf1 T C 7: 29,316,268 C357R probably damaging Het
Dync1h1 C T 12: 110,658,134 R3703C probably damaging Het
Gnl2 T C 4: 125,048,393 V397A probably damaging Het
Gramd3 A G 18: 56,432,336 E21G possibly damaging Het
Grik3 C A 4: 125,623,516 Q51K probably benign Het
Hectd2 G T 19: 36,587,380 Q20H probably damaging Het
Krtap5-1 A G 7: 142,296,496 C192R unknown Het
Lrpap1 A T 5: 35,099,233 M135K probably benign Het
Lrrc9 G A 12: 72,473,936 R664H possibly damaging Het
Mef2c T G 13: 83,652,856 V225G probably damaging Het
Nlrp9b T C 7: 20,019,338 L56P probably damaging Het
Nup133 T C 8: 123,916,281 probably null Het
Odf3 A G 7: 140,848,427 S25G probably benign Het
Olfr533 G A 7: 140,466,735 C178Y probably damaging Het
Olfr993 T A 2: 85,414,604 I92L possibly damaging Het
Ppp1r3d T C 2: 178,413,759 E150G possibly damaging Het
Smpd1 A G 7: 105,555,273 M120V probably benign Het
Zbtb46 A G 2: 181,411,836 L361P probably benign Het
Zfp605 A G 5: 110,127,997 H327R probably damaging Het
Other mutations in Eef1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0577:Eef1g UTSW 19 8973042 missense probably benign 0.02
R1871:Eef1g UTSW 19 8977966 missense possibly damaging 0.80
R3946:Eef1g UTSW 19 8969977 missense probably benign 0.23
R4698:Eef1g UTSW 19 8977966 missense possibly damaging 0.70
R6112:Eef1g UTSW 19 8977591 missense probably damaging 1.00
R6944:Eef1g UTSW 19 8968292 missense probably benign
R7665:Eef1g UTSW 19 8968289 missense probably benign 0.19
R7725:Eef1g UTSW 19 8978063 missense probably benign 0.00
R7836:Eef1g UTSW 19 8977374 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GTAAATTGCCACCCCTTCCTTAAG -3'
(R):5'- TGGTGATTCCGCAGAGAAAG -3'

Sequencing Primer
(F):5'- TTGTCACGGGTTCCAGATACCAG -3'
(R):5'- TTCCGCAGAGAAAGGGGGTG -3'
Posted On2018-07-23