Incidental Mutation 'R6672:Hectd2'
ID527184
Institutional Source Beutler Lab
Gene Symbol Hectd2
Ensembl Gene ENSMUSG00000041180
Gene NameHECT domain E3 ubiquitin protein ligase 2
SynonymsA630025O09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6672 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location36554639-36621135 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 36587380 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 20 (Q20H)
Ref Sequence ENSEMBL: ENSMUSP00000134964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047247] [ENSMUST00000139215] [ENSMUST00000169036] [ENSMUST00000177381]
Predicted Effect probably benign
Transcript: ENSMUST00000047247
AA Change: Q203H

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000042646
Gene: ENSMUSG00000041180
AA Change: Q203H

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 55 65 N/A INTRINSIC
low complexity region 109 128 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
low complexity region 314 327 N/A INTRINSIC
HECTc 433 774 1.33e-115 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139215
SMART Domains Protein: ENSMUSP00000117273
Gene: ENSMUSG00000041180

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 55 65 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149629
Predicted Effect unknown
Transcript: ENSMUST00000155594
AA Change: Q175H
SMART Domains Protein: ENSMUSP00000120791
Gene: ENSMUSG00000041180
AA Change: Q175H

DomainStartEndE-ValueType
low complexity region 28 38 N/A INTRINSIC
low complexity region 82 101 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 287 300 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169036
AA Change: Q203H

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128387
Gene: ENSMUSG00000041180
AA Change: Q203H

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 55 65 N/A INTRINSIC
low complexity region 109 128 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
low complexity region 314 327 N/A INTRINSIC
HECTc 434 775 1.33e-115 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177381
AA Change: Q20H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134964
Gene: ENSMUSG00000041180
AA Change: Q20H

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
low complexity region 131 144 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 40,681,533 E680G probably benign Het
Adam7 T A 14: 68,504,702 probably null Het
Arid2 C T 15: 96,362,345 T351I probably benign Het
Asz1 T A 6: 18,075,818 E252V possibly damaging Het
BC024978 C T 7: 27,204,064 probably benign Het
Chrm5 C T 2: 112,479,796 C325Y probably benign Het
Cyp2c65 A G 19: 39,087,674 R357G probably damaging Het
Dhx36 A G 3: 62,495,536 V265A probably damaging Het
Dhx36 T A 3: 62,500,879 E179D probably benign Het
Dip2c G A 13: 9,567,830 probably null Het
Dock10 A T 1: 80,512,531 M1958K probably benign Het
Dpf1 T C 7: 29,316,268 C357R probably damaging Het
Dync1h1 C T 12: 110,658,134 R3703C probably damaging Het
Eef1g A G 19: 8,967,047 probably null Het
Gnl2 T C 4: 125,048,393 V397A probably damaging Het
Gramd3 A G 18: 56,432,336 E21G possibly damaging Het
Grik3 C A 4: 125,623,516 Q51K probably benign Het
Krtap5-1 A G 7: 142,296,496 C192R unknown Het
Lrpap1 A T 5: 35,099,233 M135K probably benign Het
Lrrc9 G A 12: 72,473,936 R664H possibly damaging Het
Mef2c T G 13: 83,652,856 V225G probably damaging Het
Nlrp9b T C 7: 20,019,338 L56P probably damaging Het
Nup133 T C 8: 123,916,281 probably null Het
Odf3 A G 7: 140,848,427 S25G probably benign Het
Olfr533 G A 7: 140,466,735 C178Y probably damaging Het
Olfr993 T A 2: 85,414,604 I92L possibly damaging Het
Ppp1r3d T C 2: 178,413,759 E150G possibly damaging Het
Smpd1 A G 7: 105,555,273 M120V probably benign Het
Zbtb46 A G 2: 181,411,836 L361P probably benign Het
Zfp605 A G 5: 110,127,997 H327R probably damaging Het
Other mutations in Hectd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Hectd2 APN 19 36584936 missense probably benign
IGL01024:Hectd2 APN 19 36606393 missense probably damaging 1.00
IGL01111:Hectd2 APN 19 36597120 missense probably damaging 1.00
IGL01301:Hectd2 APN 19 36569370 splice site probably benign
IGL02019:Hectd2 APN 19 36615516 missense possibly damaging 0.94
IGL02410:Hectd2 APN 19 36595213 nonsense probably null
IGL02793:Hectd2 APN 19 36587421 missense probably damaging 0.99
IGL03010:Hectd2 APN 19 36615602 missense probably benign 0.01
IGL03115:Hectd2 APN 19 36599721 critical splice donor site probably null
IGL03251:Hectd2 APN 19 36585526 missense probably damaging 1.00
chopstix1 UTSW 19 36609416 missense possibly damaging 0.75
Chopstix3 UTSW 19 36615508 nonsense probably null
R0402:Hectd2 UTSW 19 36601529 critical splice donor site probably null
R0415:Hectd2 UTSW 19 36584884 unclassified probably benign
R0576:Hectd2 UTSW 19 36585497 missense probably benign
R0685:Hectd2 UTSW 19 36569431 missense probably damaging 0.99
R1460:Hectd2 UTSW 19 36615508 nonsense probably null
R1791:Hectd2 UTSW 19 36609416 missense possibly damaging 0.75
R1895:Hectd2 UTSW 19 36614460 missense probably damaging 1.00
R1928:Hectd2 UTSW 19 36612319 missense probably damaging 1.00
R2116:Hectd2 UTSW 19 36614424 missense probably damaging 0.99
R2520:Hectd2 UTSW 19 36612233 critical splice donor site probably null
R4693:Hectd2 UTSW 19 36614338 splice site probably benign
R4858:Hectd2 UTSW 19 36605282 missense probably damaging 0.98
R4943:Hectd2 UTSW 19 36604247 splice site probably null
R5031:Hectd2 UTSW 19 36599604 missense probably damaging 1.00
R5408:Hectd2 UTSW 19 36554896 missense possibly damaging 0.46
R5621:Hectd2 UTSW 19 36618751 missense probably damaging 1.00
R5652:Hectd2 UTSW 19 36604320 missense probably damaging 1.00
R5704:Hectd2 UTSW 19 36598891 missense possibly damaging 0.93
R5950:Hectd2 UTSW 19 36597239 intron probably benign
R6414:Hectd2 UTSW 19 36618786 missense probably benign 0.21
R6438:Hectd2 UTSW 19 36618842 makesense probably null
R6544:Hectd2 UTSW 19 36612328 missense probably damaging 1.00
R6545:Hectd2 UTSW 19 36587378 missense probably benign 0.35
R6629:Hectd2 UTSW 19 36615538 missense probably damaging 1.00
R6741:Hectd2 UTSW 19 36612359 missense probably damaging 1.00
R7117:Hectd2 UTSW 19 36599655 missense probably benign 0.29
R7238:Hectd2 UTSW 19 36597078 missense probably damaging 0.98
R7555:Hectd2 UTSW 19 36612403 missense probably damaging 1.00
R8184:Hectd2 UTSW 19 36604354 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GTCTCAGGAGTGAATTGGATACTG -3'
(R):5'- CCTCATAGAATCAGGCAAGGG -3'

Sequencing Primer
(F):5'- AATTGGATACTGCTCTTAGTGTCGC -3'
(R):5'- CCGGGAAAGGGGATCACATTTG -3'
Posted On2018-07-23