Incidental Mutation 'R6672:Cyp2c65'
ID527185
Institutional Source Beutler Lab
Gene Symbol Cyp2c65
Ensembl Gene ENSMUSG00000067231
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 65
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6672 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location39061015-39093944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39087674 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 357 (R357G)
Ref Sequence ENSEMBL: ENSMUSP00000084489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087236]
Predicted Effect probably damaging
Transcript: ENSMUST00000087236
AA Change: R357G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084489
Gene: ENSMUSG00000067231
AA Change: R357G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 2.1e-160 PFAM
Meta Mutation Damage Score 0.9371 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 40,681,533 E680G probably benign Het
Adam7 T A 14: 68,504,702 probably null Het
Arid2 C T 15: 96,362,345 T351I probably benign Het
Asz1 T A 6: 18,075,818 E252V possibly damaging Het
BC024978 C T 7: 27,204,064 probably benign Het
Chrm5 C T 2: 112,479,796 C325Y probably benign Het
Dhx36 A G 3: 62,495,536 V265A probably damaging Het
Dhx36 T A 3: 62,500,879 E179D probably benign Het
Dip2c G A 13: 9,567,830 probably null Het
Dock10 A T 1: 80,512,531 M1958K probably benign Het
Dpf1 T C 7: 29,316,268 C357R probably damaging Het
Dync1h1 C T 12: 110,658,134 R3703C probably damaging Het
Eef1g A G 19: 8,967,047 probably null Het
Gnl2 T C 4: 125,048,393 V397A probably damaging Het
Gramd3 A G 18: 56,432,336 E21G possibly damaging Het
Grik3 C A 4: 125,623,516 Q51K probably benign Het
Hectd2 G T 19: 36,587,380 Q20H probably damaging Het
Krtap5-1 A G 7: 142,296,496 C192R unknown Het
Lrpap1 A T 5: 35,099,233 M135K probably benign Het
Lrrc9 G A 12: 72,473,936 R664H possibly damaging Het
Mef2c T G 13: 83,652,856 V225G probably damaging Het
Nlrp9b T C 7: 20,019,338 L56P probably damaging Het
Nup133 T C 8: 123,916,281 probably null Het
Odf3 A G 7: 140,848,427 S25G probably benign Het
Olfr533 G A 7: 140,466,735 C178Y probably damaging Het
Olfr993 T A 2: 85,414,604 I92L possibly damaging Het
Ppp1r3d T C 2: 178,413,759 E150G possibly damaging Het
Smpd1 A G 7: 105,555,273 M120V probably benign Het
Zbtb46 A G 2: 181,411,836 L361P probably benign Het
Zfp605 A G 5: 110,127,997 H327R probably damaging Het
Other mutations in Cyp2c65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Cyp2c65 APN 19 39072177 critical splice acceptor site probably null
IGL01124:Cyp2c65 APN 19 39093510 utr 3 prime probably benign
IGL01895:Cyp2c65 APN 19 39072232 missense possibly damaging 0.90
IGL02544:Cyp2c65 APN 19 39090638 missense probably damaging 1.00
R0172:Cyp2c65 UTSW 19 39087656 missense possibly damaging 0.86
R0378:Cyp2c65 UTSW 19 39073218 missense probably benign 0.19
R0517:Cyp2c65 UTSW 19 39082348 splice site probably benign
R0585:Cyp2c65 UTSW 19 39069242 missense probably benign 0.00
R1770:Cyp2c65 UTSW 19 39082198 missense probably benign 0.07
R2051:Cyp2c65 UTSW 19 39082231 missense probably benign 0.12
R2310:Cyp2c65 UTSW 19 39093382 missense probably benign 0.02
R2911:Cyp2c65 UTSW 19 39087682 missense probably damaging 0.96
R4208:Cyp2c65 UTSW 19 39090655 missense probably damaging 1.00
R4258:Cyp2c65 UTSW 19 39093428 missense probably benign 0.41
R4734:Cyp2c65 UTSW 19 39072334 missense probably benign 0.00
R4821:Cyp2c65 UTSW 19 39072191 missense probably damaging 1.00
R4926:Cyp2c65 UTSW 19 39061153 missense probably benign 0.00
R5060:Cyp2c65 UTSW 19 39061070 missense unknown
R5091:Cyp2c65 UTSW 19 39087565 critical splice acceptor site probably null
R5433:Cyp2c65 UTSW 19 39093484 missense probably benign 0.00
R6051:Cyp2c65 UTSW 19 39061166 missense probably benign 0.29
R6182:Cyp2c65 UTSW 19 39061162 missense probably benign 0.18
R6400:Cyp2c65 UTSW 19 39061114 missense possibly damaging 0.80
R6586:Cyp2c65 UTSW 19 39082218 missense possibly damaging 0.89
R6850:Cyp2c65 UTSW 19 39069091 missense probably benign 0.15
R8075:Cyp2c65 UTSW 19 39072238 missense probably benign 0.10
R8756:Cyp2c65 UTSW 19 39061108 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTTTCAGAATACTGCCAGGC -3'
(R):5'- CCTGGAATTGCAAGACTCAGTATC -3'

Sequencing Primer
(F):5'- TACAAGTGACCCCCGAGTTG -3'
(R):5'- GCAAGACTCAGTATCTTGGGC -3'
Posted On2018-07-23