Incidental Mutation 'R6673:Tmem33'
ID527191
Institutional Source Beutler Lab
Gene Symbol Tmem33
Ensembl Gene ENSMUSG00000037720
Gene Nametransmembrane protein 33
Synonyms2700052H22Rik, 5430406L04Rik, 1110006G02Rik, 1600019D15Rik, 2410089A21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R6673 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location67260565-67291461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67286125 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 215 (V215A)
Ref Sequence ENSEMBL: ENSMUSP00000124390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037918] [ENSMUST00000160352] [ENSMUST00000161369] [ENSMUST00000201979]
Predicted Effect probably benign
Transcript: ENSMUST00000037918
AA Change: V215A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000042852
Gene: ENSMUSG00000037720
AA Change: V215A

DomainStartEndE-ValueType
Pfam:UPF0121 1 247 9.8e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160352
AA Change: V215A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000124766
Gene: ENSMUSG00000037720
AA Change: V215A

DomainStartEndE-ValueType
Pfam:UPF0121 1 246 2.8e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161369
AA Change: V215A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000124390
Gene: ENSMUSG00000037720
AA Change: V215A

DomainStartEndE-ValueType
Pfam:UPF0121 7 245 1.8e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201979
SMART Domains Protein: ENSMUSP00000144531
Gene: ENSMUSG00000037720

DomainStartEndE-ValueType
Pfam:UPF0121 7 61 5.9e-7 PFAM
Meta Mutation Damage Score 0.0691 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,592 M475L probably benign Het
BC067074 C T 13: 113,367,832 Q1832* probably null Het
Cenpb A T 2: 131,179,245 L211H probably damaging Het
Ckmt1 C T 2: 121,359,670 P82S probably damaging Het
Fbxo38 A G 18: 62,533,915 C138R probably damaging Het
Hkdc1 A G 10: 62,403,606 V306A probably damaging Het
Mecom T C 3: 29,980,702 N275S probably benign Het
Mpdz T C 4: 81,356,430 D185G probably benign Het
Prtg T A 9: 72,851,682 N439K probably damaging Het
Rsf1 GGCGGCGG GGCGGCGGGGGCGGCGG 7: 97,579,918 probably benign Het
Serpina3b A G 12: 104,130,669 N70D probably damaging Het
Shc1 T C 3: 89,421,962 S38P possibly damaging Het
Slc13a2 T A 11: 78,397,831 I540F probably benign Het
Trappc8 A G 18: 20,885,257 V53A probably benign Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Other mutations in Tmem33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Tmem33 APN 5 67284195 missense probably damaging 1.00
IGL02076:Tmem33 APN 5 67286103 missense probably damaging 1.00
IGL03106:Tmem33 APN 5 67263796 missense probably damaging 1.00
commonplace UTSW 5 67264459 critical splice donor site probably null
R0573:Tmem33 UTSW 5 67264260 intron probably benign
R0839:Tmem33 UTSW 5 67264308 missense probably damaging 1.00
R1129:Tmem33 UTSW 5 67264460 splice site probably null
R1438:Tmem33 UTSW 5 67267291 splice site probably null
R1692:Tmem33 UTSW 5 67268554 missense probably null 0.57
R4513:Tmem33 UTSW 5 67286125 missense probably benign 0.02
R4763:Tmem33 UTSW 5 67286136 missense probably benign 0.22
R6298:Tmem33 UTSW 5 67268551 nonsense probably null
R6813:Tmem33 UTSW 5 67264459 critical splice donor site probably null
R7186:Tmem33 UTSW 5 67263787 missense possibly damaging 0.68
R7378:Tmem33 UTSW 5 67286133 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGCAGTGTACTCCAGATTCATC -3'
(R):5'- TTTGGGACCCCTATCAGAATTAC -3'

Sequencing Primer
(F):5'- ACTTACTATGTACACCAGGCTGG -3'
(R):5'- TAAAGGCGATGCTCTGGA -3'
Posted On2018-07-23