Incidental Mutation 'R6673:Hkdc1'
ID 527194
Institutional Source Beutler Lab
Gene Symbol Hkdc1
Ensembl Gene ENSMUSG00000020080
Gene Name hexokinase domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.167) question?
Stock # R6673 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 62383137-62422491 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62403606 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 306 (V306A)
Ref Sequence ENSEMBL: ENSMUSP00000020277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020277]
AlphaFold Q91W97
Predicted Effect probably damaging
Transcript: ENSMUST00000020277
AA Change: V306A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020277
Gene: ENSMUSG00000020080
AA Change: V306A

DomainStartEndE-ValueType
Pfam:Hexokinase_1 21 220 3.3e-71 PFAM
Pfam:Hexokinase_2 225 459 5.6e-79 PFAM
Pfam:Hexokinase_1 469 665 9.5e-76 PFAM
Pfam:Hexokinase_2 670 904 5.1e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159493
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hexokinase protein family. The encoded protein is involved in glucose metabolism, and reduced expression may be associated with gestational diabetes mellitus. High expression of this gene may also be associated with poor prognosis in hepatocarcinoma. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality prior to genotyping. Mice heterozygous for a knock-out allele exhibit impaired glucose tolerance and female-specific increased in hepatic triglyceride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,592 M475L probably benign Het
BC067074 C T 13: 113,367,832 Q1832* probably null Het
Cenpb A T 2: 131,179,245 L211H probably damaging Het
Ckmt1 C T 2: 121,359,670 P82S probably damaging Het
Fbxo38 A G 18: 62,533,915 C138R probably damaging Het
Mecom T C 3: 29,980,702 N275S probably benign Het
Mpdz T C 4: 81,356,430 D185G probably benign Het
Prtg T A 9: 72,851,682 N439K probably damaging Het
Rsf1 GGCGGCGG GGCGGCGGGGGCGGCGG 7: 97,579,918 probably benign Het
Serpina3b A G 12: 104,130,669 N70D probably damaging Het
Shc1 T C 3: 89,421,962 S38P possibly damaging Het
Slc13a2 T A 11: 78,397,831 I540F probably benign Het
Tmem33 T C 5: 67,286,125 V215A probably benign Het
Trappc8 A G 18: 20,885,257 V53A probably benign Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Other mutations in Hkdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Hkdc1 APN 10 62393789 missense probably damaging 0.99
IGL01300:Hkdc1 APN 10 62395261 splice site probably benign
IGL01415:Hkdc1 APN 10 62393859 missense probably damaging 1.00
IGL01935:Hkdc1 APN 10 62400386 missense probably damaging 0.97
IGL02903:Hkdc1 APN 10 62400191 critical splice donor site probably null
IGL03100:Hkdc1 APN 10 62417829 missense probably benign 0.00
IGL03154:Hkdc1 APN 10 62385705 missense probably damaging 1.00
R0368:Hkdc1 UTSW 10 62411707 missense probably null 0.04
R0549:Hkdc1 UTSW 10 62400240 missense probably benign
R0667:Hkdc1 UTSW 10 62411865 splice site probably benign
R0751:Hkdc1 UTSW 10 62398673 missense probably damaging 0.99
R1779:Hkdc1 UTSW 10 62391383 missense probably damaging 1.00
R1929:Hkdc1 UTSW 10 62417898 missense probably benign 0.01
R2271:Hkdc1 UTSW 10 62417898 missense probably benign 0.01
R3831:Hkdc1 UTSW 10 62400212 missense probably benign
R4480:Hkdc1 UTSW 10 62391372 missense probably benign
R4561:Hkdc1 UTSW 10 62409839 missense probably benign 0.00
R4576:Hkdc1 UTSW 10 62385843 missense possibly damaging 0.56
R4655:Hkdc1 UTSW 10 62400463 missense probably benign 0.09
R4723:Hkdc1 UTSW 10 62400354 missense probably benign 0.00
R4810:Hkdc1 UTSW 10 62411525 missense probably benign 0.08
R5086:Hkdc1 UTSW 10 62395274 intron probably benign
R5138:Hkdc1 UTSW 10 62398691 missense probably damaging 1.00
R5781:Hkdc1 UTSW 10 62417933 missense probably damaging 0.98
R5900:Hkdc1 UTSW 10 62408666 missense possibly damaging 0.91
R5982:Hkdc1 UTSW 10 62393810 missense probably benign
R6418:Hkdc1 UTSW 10 62383804 missense possibly damaging 0.93
R6463:Hkdc1 UTSW 10 62393702 missense probably damaging 1.00
R6612:Hkdc1 UTSW 10 62395441 missense possibly damaging 0.48
R6761:Hkdc1 UTSW 10 62408698 missense possibly damaging 0.93
R6915:Hkdc1 UTSW 10 62401932 missense possibly damaging 0.92
R7114:Hkdc1 UTSW 10 62393843 missense probably damaging 1.00
R7395:Hkdc1 UTSW 10 62385699 missense probably damaging 1.00
R8498:Hkdc1 UTSW 10 62385883 missense probably benign
R8777:Hkdc1 UTSW 10 62398833 missense possibly damaging 0.94
R8777-TAIL:Hkdc1 UTSW 10 62398833 missense possibly damaging 0.94
R8894:Hkdc1 UTSW 10 62408621 missense probably damaging 1.00
R8989:Hkdc1 UTSW 10 62393765 missense probably damaging 1.00
R9331:Hkdc1 UTSW 10 62400335 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTCCACAGAGTCAAGAAGG -3'
(R):5'- AGAAGCACCCAGGTCTTTGC -3'

Sequencing Primer
(F):5'- CCACAGAGTCAAGAAGGAGGGAC -3'
(R):5'- ACCCAGGTCTTTGCTCTGGTG -3'
Posted On 2018-07-23