Incidental Mutation 'R6673:Serpina3b'
ID 527197
Institutional Source Beutler Lab
Gene Symbol Serpina3b
Ensembl Gene ENSMUSG00000066364
Gene Name serine (or cysteine) peptidase inhibitor, clade A, member 3B
Synonyms antitrypsin, A030003A19Rik, alpha-1 antiproteinase, 6A1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R6673 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 104127996-104139545 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104130669 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 70 (N70D)
Ref Sequence ENSEMBL: ENSMUSP00000082127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085052]
AlphaFold Q8BYY9
Predicted Effect probably damaging
Transcript: ENSMUST00000085052
AA Change: N70D

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082127
Gene: ENSMUSG00000066364
AA Change: N70D

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 56 417 1.1e-153 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,592 M475L probably benign Het
BC067074 C T 13: 113,367,832 Q1832* probably null Het
Cenpb A T 2: 131,179,245 L211H probably damaging Het
Ckmt1 C T 2: 121,359,670 P82S probably damaging Het
Fbxo38 A G 18: 62,533,915 C138R probably damaging Het
Hkdc1 A G 10: 62,403,606 V306A probably damaging Het
Mecom T C 3: 29,980,702 N275S probably benign Het
Mpdz T C 4: 81,356,430 D185G probably benign Het
Prtg T A 9: 72,851,682 N439K probably damaging Het
Rsf1 GGCGGCGG GGCGGCGGGGGCGGCGG 7: 97,579,918 probably benign Het
Shc1 T C 3: 89,421,962 S38P possibly damaging Het
Slc13a2 T A 11: 78,397,831 I540F probably benign Het
Tmem33 T C 5: 67,286,125 V215A probably benign Het
Trappc8 A G 18: 20,885,257 V53A probably benign Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Other mutations in Serpina3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Serpina3b APN 12 104138787 missense probably benign 0.03
IGL00427:Serpina3b APN 12 104132941 missense probably benign 0.06
IGL01637:Serpina3b APN 12 104132957 missense probably benign 0.00
IGL01738:Serpina3b APN 12 104130832 missense probably damaging 1.00
IGL02403:Serpina3b APN 12 104130462 start codon destroyed probably null 1.00
IGL03118:Serpina3b APN 12 104131054 missense probably benign 0.22
R0141:Serpina3b UTSW 12 104130771 missense probably damaging 1.00
R0217:Serpina3b UTSW 12 104130727 missense probably damaging 1.00
R0437:Serpina3b UTSW 12 104130670 missense probably damaging 1.00
R1295:Serpina3b UTSW 12 104130879 missense probably damaging 1.00
R1463:Serpina3b UTSW 12 104138710 missense probably benign 0.02
R1802:Serpina3b UTSW 12 104138637 missense probably damaging 1.00
R2104:Serpina3b UTSW 12 104138810 missense probably benign 0.01
R3871:Serpina3b UTSW 12 104138788 missense probably damaging 1.00
R4720:Serpina3b UTSW 12 104130630 missense possibly damaging 0.80
R5827:Serpina3b UTSW 12 104130777 missense probably benign 0.02
R5970:Serpina3b UTSW 12 104134091 missense possibly damaging 0.82
R6014:Serpina3b UTSW 12 104131097 missense possibly damaging 0.93
R6102:Serpina3b UTSW 12 104134169 missense probably benign 0.00
R6807:Serpina3b UTSW 12 104132992 missense probably benign 0.00
R6836:Serpina3b UTSW 12 104134082 missense probably benign 0.30
R6893:Serpina3b UTSW 12 104133026 missense probably benign 0.04
R7414:Serpina3b UTSW 12 104132886 missense probably benign 0.03
R7539:Serpina3b UTSW 12 104130711 missense possibly damaging 0.75
R7748:Serpina3b UTSW 12 104130463 start codon destroyed probably null 1.00
R7817:Serpina3b UTSW 12 104132964 missense probably benign 0.01
R8040:Serpina3b UTSW 12 104131076 missense probably benign 0.00
R8143:Serpina3b UTSW 12 104130534 missense probably benign 0.06
R8360:Serpina3b UTSW 12 104138703 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCTCTAGGGCTCTTAATGG -3'
(R):5'- GCATTGCCTGTCCTGATCTG -3'

Sequencing Primer
(F):5'- CTCTAGGGCTCTTAATGGCTGAGATC -3'
(R):5'- TGTACCTGGTCCCCTGGATG -3'
Posted On 2018-07-23