Mutagenetix > Incidental Mutation

Incidental Mutation 'R6673:Serpina3b'

527197

Institutional Source

Beutler Lab

Gene Symbol

Serpina3b

Ensembl Gene

ENSMUSG00000066364

Gene Name

serine (or cysteine) peptidase inhibitor, clade A, member 3B

Synonyms

antitrypsin, A030003A19Rik, alpha-1 antiproteinase, 6A1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R6673 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

104127996-104139545 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 104130669 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 70 (N70D)

Ref Sequence

ENSEMBL: ENSMUSP00000082127 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085052]

AlphaFold

Q8BYY9

Predicted Effect

probably damaging
Transcript: ENSMUST00000085052
AA Change: N70D

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000082127
Gene: ENSMUSG00000066364
AA Change: N70D

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
SERPIN	56	417	1.1e-153	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 15 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	T	A	14: 49,770,592	M475L	probably benign	Het
BC067074	C	T	13: 113,367,832	Q1832*	probably null	Het
Cenpb	A	T	2: 131,179,245	L211H	probably damaging	Het
Ckmt1	C	T	2: 121,359,670	P82S	probably damaging	Het
Fbxo38	A	G	18: 62,533,915	C138R	probably damaging	Het
Hkdc1	A	G	10: 62,403,606	V306A	probably damaging	Het
Mecom	T	C	3: 29,980,702	N275S	probably benign	Het
Mpdz	T	C	4: 81,356,430	D185G	probably benign	Het
Prtg	T	A	9: 72,851,682	N439K	probably damaging	Het
Rsf1	GGCGGCGG	GGCGGCGGGGGCGGCGG	7: 97,579,918		probably benign	Het
Shc1	T	C	3: 89,421,962	S38P	possibly damaging	Het
Slc13a2	T	A	11: 78,397,831	I540F	probably benign	Het
Tmem33	T	C	5: 67,286,125	V215A	probably benign	Het
Trappc8	A	G	18: 20,885,257	V53A	probably benign	Het
Trim41	TTCCTCCTCCTCCTCCTCCTCCTCCTCC	TTCCTCCTCCTCCTCCTCCTCCTCC	11: 48,816,257		probably benign	Het

Other mutations in Serpina3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Serpina3b	APN	12	104138787	missense	probably benign	0.03
IGL00427:Serpina3b	APN	12	104132941	missense	probably benign	0.06
IGL01637:Serpina3b	APN	12	104132957	missense	probably benign	0.00
IGL01738:Serpina3b	APN	12	104130832	missense	probably damaging	1.00
IGL02403:Serpina3b	APN	12	104130462	start codon destroyed	probably null	1.00
IGL03118:Serpina3b	APN	12	104131054	missense	probably benign	0.22
R0141:Serpina3b	UTSW	12	104130771	missense	probably damaging	1.00
R0217:Serpina3b	UTSW	12	104130727	missense	probably damaging	1.00
R0437:Serpina3b	UTSW	12	104130670	missense	probably damaging	1.00
R1295:Serpina3b	UTSW	12	104130879	missense	probably damaging	1.00
R1463:Serpina3b	UTSW	12	104138710	missense	probably benign	0.02
R1802:Serpina3b	UTSW	12	104138637	missense	probably damaging	1.00
R2104:Serpina3b	UTSW	12	104138810	missense	probably benign	0.01
R3871:Serpina3b	UTSW	12	104138788	missense	probably damaging	1.00
R4720:Serpina3b	UTSW	12	104130630	missense	possibly damaging	0.80
R5827:Serpina3b	UTSW	12	104130777	missense	probably benign	0.02
R5970:Serpina3b	UTSW	12	104134091	missense	possibly damaging	0.82
R6014:Serpina3b	UTSW	12	104131097	missense	possibly damaging	0.93
R6102:Serpina3b	UTSW	12	104134169	missense	probably benign	0.00
R6807:Serpina3b	UTSW	12	104132992	missense	probably benign	0.00
R6836:Serpina3b	UTSW	12	104134082	missense	probably benign	0.30
R6893:Serpina3b	UTSW	12	104133026	missense	probably benign	0.04
R7414:Serpina3b	UTSW	12	104132886	missense	probably benign	0.03
R7539:Serpina3b	UTSW	12	104130711	missense	possibly damaging	0.75
R7748:Serpina3b	UTSW	12	104130463	start codon destroyed	probably null	1.00
R7817:Serpina3b	UTSW	12	104132964	missense	probably benign	0.01
R8040:Serpina3b	UTSW	12	104131076	missense	probably benign	0.00
R8143:Serpina3b	UTSW	12	104130534	missense	probably benign	0.06
R8360:Serpina3b	UTSW	12	104138703	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAGCTCTAGGGCTCTTAATGG -3'
(R):5'- GCATTGCCTGTCCTGATCTG -3'

Sequencing Primer
(F):5'- CTCTAGGGCTCTTAATGGCTGAGATC -3'
(R):5'- TGTACCTGGTCCCCTGGATG -3'

Posted On

2018-07-23