Mutagenetix > Incidental Mutation

Incidental Mutation 'R6674:Sphkap'

527203

Institutional Source

Beutler Lab

Gene Symbol

Sphkap

Ensembl Gene

ENSMUSG00000026163

Gene Name

SPHK1 interactor, AKAP domain containing

Synonyms

4930544G21Rik, A930009L15Rik, SKIP

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R6674 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

83254139-83408200 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 83277834 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 444 (S444R)

Ref Sequence

ENSEMBL: ENSMUSP00000124384 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159078] [ENSMUST00000160953]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000053075

Predicted Effect

probably benign
Transcript: ENSMUST00000159078
AA Change: S444R

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000124384
Gene: ENSMUSG00000026163
AA Change: S444R

Domain	Start	End	E-Value	Type
low complexity region	303	314	N/A	INTRINSIC
SCOP:d1ash__	382	462	5e-3	SMART
low complexity region	809	819	N/A	INTRINSIC
low complexity region	854	865	N/A	INTRINSIC
low complexity region	1202	1221	N/A	INTRINSIC
low complexity region	1243	1254	N/A	INTRINSIC
Pfam:AKAP_110	1281	1398	7.5e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000160953
AA Change: S731R

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000124872
Gene: ENSMUSG00000026163
AA Change: S731R

Domain	Start	End	E-Value	Type
low complexity region	590	601	N/A	INTRINSIC
SCOP:d1ash__	669	749	6e-3	SMART
low complexity region	1096	1106	N/A	INTRINSIC
low complexity region	1141	1152	N/A	INTRINSIC
low complexity region	1489	1508	N/A	INTRINSIC
Pfam:AKAP_110	1540	1655	6.4e-12	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	T	C	19: 45,974,998	E92G	probably benign	Het
Cluh	A	G	11: 74,666,227	H1005R	probably damaging	Het
Coro2b	C	T	9: 62,432,427	R13H	probably damaging	Het
Depdc1a	T	A	3: 159,526,707	N698K	probably benign	Het
Dusp12	G	A	1: 170,879,748	T257I	probably benign	Het
Esf1	T	A	2: 140,120,806	K782*	probably null	Het
Extl1	T	C	4: 134,358,127	T560A	probably damaging	Het
Gpr179	C	A	11: 97,347,405		probably null	Het
Krt90	G	A	15: 101,557,326	L287F	probably damaging	Het
Mertk	T	C	2: 128,729,357	V77A	probably benign	Het
Nr4a2	C	T	2: 57,112,424	A6T	probably damaging	Het
Pdzd8	G	A	19: 59,301,369	P533L	probably damaging	Het
Plxnb1	G	A	9: 109,108,146	G1132R	probably benign	Het
Ppfia2	A	G	10: 106,927,772	I1209V	probably benign	Het
Slc26a9	A	T	1: 131,765,018	Q696L	probably benign	Het
Tmem144	A	G	3: 79,839,183	F22L	possibly damaging	Het
Tomm20l	A	G	12: 71,111,533	D30G	probably damaging	Het
Trpc2	A	G	7: 102,096,057	T827A	probably benign	Het
Unc50	T	C	1: 37,437,458	V208A	probably benign	Het
Vmn1r125	T	C	7: 21,272,713	S179P	probably damaging	Het
Vmn1r225	A	C	17: 20,503,115	I273L	probably benign	Het
Vmn2r117	G	A	17: 23,460,049	Q734*	probably null	Het
Vmn2r88	A	G	14: 51,414,338	I378V	probably benign	Het
Zfp507	C	T	7: 35,794,734	V295I	probably damaging	Het
Zfp981	A	G	4: 146,535,493	R35G	probably damaging	Het

Other mutations in Sphkap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Sphkap	APN	1	83280516	missense	probably damaging	1.00
IGL00337:Sphkap	APN	1	83339608	missense	probably damaging	1.00
IGL00470:Sphkap	APN	1	83277910	missense	possibly damaging	0.87
IGL00577:Sphkap	APN	1	83278844	missense	probably damaging	1.00
IGL00657:Sphkap	APN	1	83276375	missense	probably damaging	1.00
IGL01868:Sphkap	APN	1	83280399	splice site	probably null
IGL02101:Sphkap	APN	1	83290987	missense	probably damaging	1.00
IGL02471:Sphkap	APN	1	83276176	missense	probably damaging	1.00
IGL02943:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL02945:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03008:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03031:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03059:Sphkap	APN	1	83257242	missense	probably damaging	0.97
IGL03085:Sphkap	APN	1	83280354	missense	possibly damaging	0.92
IGL03355:Sphkap	APN	1	83280503	missense	probably damaging	1.00
IGL03356:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03368:Sphkap	APN	1	83275676	missense	probably benign	0.14
R0294:Sphkap	UTSW	1	83278245	missense	possibly damaging	0.72
R0308:Sphkap	UTSW	1	83276969	missense	probably damaging	1.00
R0478:Sphkap	UTSW	1	83278711	missense	probably damaging	1.00
R0606:Sphkap	UTSW	1	83280424	missense	probably damaging	1.00
R0678:Sphkap	UTSW	1	83278628	missense	probably benign	0.03
R1216:Sphkap	UTSW	1	83290977	missense	probably damaging	1.00
R1253:Sphkap	UTSW	1	83278898	missense	possibly damaging	0.56
R1532:Sphkap	UTSW	1	83257203	missense	probably damaging	1.00
R1635:Sphkap	UTSW	1	83278400	missense	probably benign	0.03
R1655:Sphkap	UTSW	1	83277515	nonsense	probably null
R1657:Sphkap	UTSW	1	83277515	nonsense	probably null
R1700:Sphkap	UTSW	1	83277515	nonsense	probably null
R1701:Sphkap	UTSW	1	83277515	nonsense	probably null
R1734:Sphkap	UTSW	1	83277515	nonsense	probably null
R1736:Sphkap	UTSW	1	83277515	nonsense	probably null
R1743:Sphkap	UTSW	1	83277515	nonsense	probably null
R1744:Sphkap	UTSW	1	83277515	nonsense	probably null
R1760:Sphkap	UTSW	1	83277544	missense	probably benign	0.29
R1893:Sphkap	UTSW	1	83278966	missense	probably benign	0.02
R1937:Sphkap	UTSW	1	83267441	nonsense	probably null
R1986:Sphkap	UTSW	1	83277922	missense	probably damaging	1.00
R1993:Sphkap	UTSW	1	83277515	nonsense	probably null
R1995:Sphkap	UTSW	1	83277515	nonsense	probably null
R2001:Sphkap	UTSW	1	83276662	missense	probably damaging	1.00
R2004:Sphkap	UTSW	1	83277911	missense	probably benign	0.04
R2111:Sphkap	UTSW	1	83275881	missense	probably benign	0.00
R2112:Sphkap	UTSW	1	83275881	missense	probably benign	0.00
R2156:Sphkap	UTSW	1	83277989	missense	probably benign	0.03
R2182:Sphkap	UTSW	1	83276684	missense	probably damaging	1.00
R2271:Sphkap	UTSW	1	83257221	missense	probably damaging	1.00
R3712:Sphkap	UTSW	1	83277112	missense	probably benign	0.27
R3919:Sphkap	UTSW	1	83276458	missense	probably damaging	1.00
R3980:Sphkap	UTSW	1	83267494	splice site	probably null
R4130:Sphkap	UTSW	1	83277898	missense	probably damaging	0.96
R4539:Sphkap	UTSW	1	83277793	missense	probably benign	0.00
R4602:Sphkap	UTSW	1	83279061	nonsense	probably null
R4735:Sphkap	UTSW	1	83279117	missense	probably benign	0.01
R4793:Sphkap	UTSW	1	83278084	missense	possibly damaging	0.77
R4849:Sphkap	UTSW	1	83277384	missense	probably benign	0.03
R4880:Sphkap	UTSW	1	83288817	missense	probably damaging	1.00
R5213:Sphkap	UTSW	1	83280503	missense	probably damaging	1.00
R5277:Sphkap	UTSW	1	83276164	missense	probably benign	0.04
R5331:Sphkap	UTSW	1	83276782	missense	probably benign	0.08
R5632:Sphkap	UTSW	1	83278285	missense	probably benign	0.01
R5647:Sphkap	UTSW	1	83407999	missense	probably damaging	0.98
R5751:Sphkap	UTSW	1	83275897	missense	probably benign	0.27
R5935:Sphkap	UTSW	1	83339599	missense	probably damaging	1.00
R5999:Sphkap	UTSW	1	83267405	missense	probably benign	0.02
R6232:Sphkap	UTSW	1	83280479	missense	probably damaging	1.00
R6318:Sphkap	UTSW	1	83278378	missense	probably damaging	1.00
R6474:Sphkap	UTSW	1	83278823	missense	probably damaging	1.00
R6602:Sphkap	UTSW	1	83275758	missense	possibly damaging	0.75
R6716:Sphkap	UTSW	1	83362228	critical splice donor site	probably null
R6803:Sphkap	UTSW	1	83280510	missense	probably damaging	1.00
R6880:Sphkap	UTSW	1	83257257	missense	probably damaging	1.00
R6941:Sphkap	UTSW	1	83408090	start gained	probably benign
R7170:Sphkap	UTSW	1	83265985	missense	probably damaging	0.99
R7263:Sphkap	UTSW	1	83276678	missense	probably damaging	1.00
R7422:Sphkap	UTSW	1	83263826	missense	probably benign	0.02
R7640:Sphkap	UTSW	1	83278928	missense	possibly damaging	0.94
R7722:Sphkap	UTSW	1	83278921	missense	probably benign	0.00
R7810:Sphkap	UTSW	1	83276300	missense	probably damaging	1.00
R7887:Sphkap	UTSW	1	83277412	missense	probably benign	0.00
R7974:Sphkap	UTSW	1	83278962	missense	probably damaging	1.00
R7990:Sphkap	UTSW	1	83267345	missense	probably damaging	0.99
R8096:Sphkap	UTSW	1	83277558	missense	probably damaging	0.98
R8110:Sphkap	UTSW	1	83278771	missense	possibly damaging	0.82
R8125:Sphkap	UTSW	1	83263582	missense	probably damaging	1.00
R8153:Sphkap	UTSW	1	83278009	missense	possibly damaging	0.93
R8245:Sphkap	UTSW	1	83278771	missense	probably benign	0.14
R8394:Sphkap	UTSW	1	83276076	missense	probably benign	0.08
R8443:Sphkap	UTSW	1	83278232	missense	probably benign	0.00
R8508:Sphkap	UTSW	1	83276500	missense	probably damaging	1.00
R8531:Sphkap	UTSW	1	83277188	missense	probably damaging	1.00
R8673:Sphkap	UTSW	1	83275840	missense	probably benign	0.01
R8674:Sphkap	UTSW	1	83277844	missense	probably benign	0.04
R8682:Sphkap	UTSW	1	83279276	missense	probably benign	0.21
R8837:Sphkap	UTSW	1	83275663	missense	possibly damaging	0.87
R8857:Sphkap	UTSW	1	83280567	missense	probably damaging	1.00
R8902:Sphkap	UTSW	1	83278964	missense	probably benign	0.21
R8916:Sphkap	UTSW	1	83277387	missense	possibly damaging	0.87
R8944:Sphkap	UTSW	1	83279206	missense	probably benign	0.39
R9154:Sphkap	UTSW	1	83257261	missense	probably damaging	1.00
R9579:Sphkap	UTSW	1	83277574	missense	probably damaging	0.99
R9616:Sphkap	UTSW	1	83277268	missense	probably damaging	1.00
R9781:Sphkap	UTSW	1	83278051	missense	possibly damaging	0.62
Z1088:Sphkap	UTSW	1	83276608	missense	probably damaging	1.00
Z1088:Sphkap	UTSW	1	83278604	missense	probably damaging	1.00
Z1176:Sphkap	UTSW	1	83276033	nonsense	probably null
Z1176:Sphkap	UTSW	1	83280442	missense	possibly damaging	0.61
Z1177:Sphkap	UTSW	1	83276431	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TTCAGATTGCAACCTGGGG -3'
(R):5'- TCAAAGGAATGAACTGGCACAC -3'

Sequencing Primer
(F):5'- GTTGTTGACCAGTTCTGGCC -3'
(R):5'- GGAATGAACTGGCACACACCTTG -3'

Posted On

2018-07-23