Incidental Mutation 'R6674:Mertk'
ID527207
Institutional Source Beutler Lab
Gene Symbol Mertk
Ensembl Gene ENSMUSG00000014361
Gene Namec-mer proto-oncogene tyrosine kinase
SynonymsNyk, nmf12, Tyro 12, Eyk, Mer
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R6674 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location128698956-128802894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128729357 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 77 (V77A)
Ref Sequence ENSEMBL: ENSMUSP00000014505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014505]
Predicted Effect probably benign
Transcript: ENSMUST00000014505
AA Change: V77A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: V77A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 94 189 8.99e-6 SMART
IG 198 276 1.54e-4 SMART
FN3 279 363 7.23e-8 SMART
FN3 379 465 6.16e-2 SMART
transmembrane domain 498 520 N/A INTRINSIC
TyrKc 582 849 2.88e-129 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik T C 19: 45,974,998 E92G probably benign Het
Cluh A G 11: 74,666,227 H1005R probably damaging Het
Coro2b C T 9: 62,432,427 R13H probably damaging Het
Depdc1a T A 3: 159,526,707 N698K probably benign Het
Dusp12 G A 1: 170,879,748 T257I probably benign Het
Esf1 T A 2: 140,120,806 K782* probably null Het
Extl1 T C 4: 134,358,127 T560A probably damaging Het
Gpr179 C A 11: 97,347,405 probably null Het
Krt90 G A 15: 101,557,326 L287F probably damaging Het
Nr4a2 C T 2: 57,112,424 A6T probably damaging Het
Pdzd8 G A 19: 59,301,369 P533L probably damaging Het
Plxnb1 G A 9: 109,108,146 G1132R probably benign Het
Ppfia2 A G 10: 106,927,772 I1209V probably benign Het
Slc26a9 A T 1: 131,765,018 Q696L probably benign Het
Sphkap A T 1: 83,277,834 S444R probably benign Het
Tmem144 A G 3: 79,839,183 F22L possibly damaging Het
Tomm20l A G 12: 71,111,533 D30G probably damaging Het
Trpc2 A G 7: 102,096,057 T827A probably benign Het
Unc50 T C 1: 37,437,458 V208A probably benign Het
Vmn1r125 T C 7: 21,272,713 S179P probably damaging Het
Vmn1r225 A C 17: 20,503,115 I273L probably benign Het
Vmn2r117 G A 17: 23,460,049 Q734* probably null Het
Vmn2r88 A G 14: 51,414,338 I378V probably benign Het
Zfp507 C T 7: 35,794,734 V295I probably damaging Het
Zfp981 A G 4: 146,535,493 R35G probably damaging Het
Other mutations in Mertk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Mertk APN 2 128783967 missense probably damaging 1.00
IGL01561:Mertk APN 2 128736636 missense probably damaging 1.00
IGL01873:Mertk APN 2 128729275 missense possibly damaging 0.93
IGL02539:Mertk APN 2 128801290 missense probably damaging 1.00
IGL02652:Mertk APN 2 128801270 missense probably benign
IGL02962:Mertk APN 2 128777454 missense probably damaging 1.00
IGL03237:Mertk APN 2 128790272 missense probably damaging 1.00
PIT4378001:Mertk UTSW 2 128782617 critical splice donor site probably null
R0118:Mertk UTSW 2 128759166 missense probably damaging 0.99
R0281:Mertk UTSW 2 128782621 splice site probably benign
R0491:Mertk UTSW 2 128793107 critical splice donor site probably null
R0565:Mertk UTSW 2 128771483 missense probably benign 0.20
R0628:Mertk UTSW 2 128738313 missense probably damaging 1.00
R1260:Mertk UTSW 2 128762152 missense probably benign 0.03
R1406:Mertk UTSW 2 128771486 missense probably benign 0.00
R1406:Mertk UTSW 2 128771486 missense probably benign 0.00
R1423:Mertk UTSW 2 128778963 missense probably damaging 1.00
R1523:Mertk UTSW 2 128790328 critical splice donor site probably null
R1539:Mertk UTSW 2 128782526 missense probably benign 0.05
R1680:Mertk UTSW 2 128801636 missense probably benign 0.03
R1770:Mertk UTSW 2 128750174 missense probably benign 0.10
R1832:Mertk UTSW 2 128762212 missense probably benign 0.10
R1870:Mertk UTSW 2 128801196 missense probably benign 0.01
R1959:Mertk UTSW 2 128759090 missense probably damaging 0.98
R2078:Mertk UTSW 2 128794458 missense probably damaging 1.00
R2125:Mertk UTSW 2 128762138 missense probably benign
R2178:Mertk UTSW 2 128793064 missense probably damaging 1.00
R2220:Mertk UTSW 2 128801472 missense probably benign 0.18
R4128:Mertk UTSW 2 128777438 nonsense probably null
R4664:Mertk UTSW 2 128801212 missense probably benign 0.24
R4740:Mertk UTSW 2 128751994 missense probably damaging 1.00
R4822:Mertk UTSW 2 128801305 missense probably benign 0.00
R4839:Mertk UTSW 2 128782576 missense probably damaging 0.97
R4874:Mertk UTSW 2 128750159 missense probably damaging 1.00
R4899:Mertk UTSW 2 128783925 missense probably damaging 1.00
R5010:Mertk UTSW 2 128784000 missense probably benign 0.03
R5128:Mertk UTSW 2 128738247 missense probably damaging 0.97
R5251:Mertk UTSW 2 128729455 missense probably damaging 1.00
R5276:Mertk UTSW 2 128801314 missense possibly damaging 0.87
R5397:Mertk UTSW 2 128771464 missense possibly damaging 0.86
R5575:Mertk UTSW 2 128736565 missense probably damaging 1.00
R5605:Mertk UTSW 2 128738307 missense probably benign 0.43
R5705:Mertk UTSW 2 128771401 missense probably benign 0.00
R5987:Mertk UTSW 2 128771374 missense probably benign 0.01
R6127:Mertk UTSW 2 128738291 missense probably damaging 0.99
R6556:Mertk UTSW 2 128776421 missense probably benign 0.23
R6671:Mertk UTSW 2 128752023 critical splice donor site probably null
R6841:Mertk UTSW 2 128759230 splice site probably null
R7153:Mertk UTSW 2 128736649 missense probably damaging 0.99
R7192:Mertk UTSW 2 128793108 splice site probably null
R7225:Mertk UTSW 2 128801562 missense possibly damaging 0.94
R7344:Mertk UTSW 2 128771497 missense probably benign
R7414:Mertk UTSW 2 128729393 missense possibly damaging 0.95
X0067:Mertk UTSW 2 128729567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTGGACTAAGCATCTGAATTG -3'
(R):5'- TTGAATGATGTGCCCCGAGC -3'

Sequencing Primer
(F):5'- GGCTAAAACTCCAATCTTCTGC -3'
(R):5'- GCCCCGAGCAATTCCTTTC -3'
Posted On2018-07-23