Mutagenetix > Incidental Mutation

Incidental Mutation 'R6674:Cluh'

527219

Institutional Source

Beutler Lab

Gene Symbol

Cluh

Ensembl Gene

ENSMUSG00000020741

Gene Name

clustered mitochondria (cluA/CLU1) homolog

Synonyms

1300001I01Rik

MMRRC Submission

044794-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.212) question?

Stock #

R6674 (G1)

Quality Score

224.009

Status

Not validated

Chromosome

Chromosomal Location

74649495-74670847 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74666227 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1005 (H1005R)

Ref Sequence

ENSEMBL: ENSMUSP00000113371 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092915] [ENSMUST00000117818]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000092915
AA Change: H1056R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090593
Gene: ENSMUSG00000020741
AA Change: H1056R

Domain	Start	End	E-Value	Type
Pfam:CLU_N	104	177	3.1e-28	PFAM
Pfam:CLU	394	614	3.4e-89	PFAM
Pfam:eIF3_p135	806	988	1.3e-58	PFAM
Pfam:TPR_10	1059	1100	2.9e-7	PFAM
low complexity region	1114	1125	N/A	INTRINSIC
Pfam:TPR_12	1140	1218	1.7e-10	PFAM
low complexity region	1316	1334	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000117818
AA Change: H1005R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113371
Gene: ENSMUSG00000020741
AA Change: H1005R

Domain	Start	End	E-Value	Type
Pfam:CLU_N	102	177	9.8e-30	PFAM
Pfam:CLU	394	615	5.3e-92	PFAM
Pfam:eIF3_p135	796	938	2.9e-38	PFAM
Pfam:TPR_10	1008	1049	9.5e-7	PFAM
low complexity region	1063	1074	N/A	INTRINSIC
Pfam:TPR_12	1089	1167	1.1e-9	PFAM
low complexity region	1265	1283	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128155

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155558

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Constitutive homozygous KO affects liver mitochondrial function and leads to neonatal lethality. Conditional homozygous KO in the adult liver affects cellular respiration under energy stress conditions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	T	C	19: 45,974,998	E92G	probably benign	Het
Coro2b	C	T	9: 62,432,427	R13H	probably damaging	Het
Depdc1a	T	A	3: 159,526,707	N698K	probably benign	Het
Dusp12	G	A	1: 170,879,748	T257I	probably benign	Het
Esf1	T	A	2: 140,120,806	K782*	probably null	Het
Extl1	T	C	4: 134,358,127	T560A	probably damaging	Het
Gpr179	C	A	11: 97,347,405		probably null	Het
Krt90	G	A	15: 101,557,326	L287F	probably damaging	Het
Mertk	T	C	2: 128,729,357	V77A	probably benign	Het
Nr4a2	C	T	2: 57,112,424	A6T	probably damaging	Het
Pdzd8	G	A	19: 59,301,369	P533L	probably damaging	Het
Plxnb1	G	A	9: 109,108,146	G1132R	probably benign	Het
Ppfia2	A	G	10: 106,927,772	I1209V	probably benign	Het
Slc26a9	A	T	1: 131,765,018	Q696L	probably benign	Het
Sphkap	A	T	1: 83,277,834	S444R	probably benign	Het
Tmem144	A	G	3: 79,839,183	F22L	possibly damaging	Het
Tomm20l	A	G	12: 71,111,533	D30G	probably damaging	Het
Trpc2	A	G	7: 102,096,057	T827A	probably benign	Het
Unc50	T	C	1: 37,437,458	V208A	probably benign	Het
Vmn1r125	T	C	7: 21,272,713	S179P	probably damaging	Het
Vmn1r225	A	C	17: 20,503,115	I273L	probably benign	Het
Vmn2r117	G	A	17: 23,460,049	Q734*	probably null	Het
Vmn2r88	A	G	14: 51,414,338	I378V	probably benign	Het
Zfp507	C	T	7: 35,794,734	V295I	probably damaging	Het
Zfp981	A	G	4: 146,535,493	R35G	probably damaging	Het

Other mutations in Cluh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Cluh	APN	11	74664064	missense	probably benign	0.28
IGL00858:Cluh	APN	11	74659605	missense	possibly damaging	0.86
IGL01380:Cluh	APN	11	74665946	missense	probably benign	0.04
IGL02402:Cluh	APN	11	74657171	missense	probably damaging	1.00
IGL02620:Cluh	APN	11	74665067	nonsense	probably null
IGL02990:Cluh	APN	11	74667765	splice site	probably null
IGL03163:Cluh	APN	11	74666068	missense	probably benign	0.44
IGL03208:Cluh	APN	11	74669506	splice site	probably null
IGL03293:Cluh	APN	11	74665752	missense	probably benign	0.03
IGL03408:Cluh	APN	11	74665953	missense	probably benign	0.06
spent	UTSW	11	74660372	missense	probably damaging	1.00
FR4342:Cluh	UTSW	11	74669524	small insertion	probably benign
FR4342:Cluh	UTSW	11	74669526	small insertion	probably benign
FR4449:Cluh	UTSW	11	74669532	small insertion	probably benign
FR4589:Cluh	UTSW	11	74669531	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669514	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669519	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669524	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669533	small insertion	probably benign
FR4976:Cluh	UTSW	11	74669520	small insertion	probably benign
R0147:Cluh	UTSW	11	74665938	missense	probably damaging	1.00
R0153:Cluh	UTSW	11	74657350	splice site	probably benign
R0506:Cluh	UTSW	11	74664894	missense	probably benign	0.20
R0526:Cluh	UTSW	11	74665986	missense	probably benign	0.05
R0834:Cluh	UTSW	11	74663805	missense	probably benign	0.02
R1873:Cluh	UTSW	11	74662076	missense	possibly damaging	0.72
R1991:Cluh	UTSW	11	74659529	nonsense	probably null
R1992:Cluh	UTSW	11	74660002	missense	probably damaging	1.00
R2095:Cluh	UTSW	11	74661724	nonsense	probably null
R2101:Cluh	UTSW	11	74660502	splice site	probably benign
R2103:Cluh	UTSW	11	74659529	nonsense	probably null
R2220:Cluh	UTSW	11	74667121	missense	probably damaging	1.00
R3702:Cluh	UTSW	11	74665356	missense	probably benign
R3853:Cluh	UTSW	11	74656453	missense	probably benign	0.00
R3900:Cluh	UTSW	11	74667104	missense	probably benign	0.29
R4891:Cluh	UTSW	11	74665059	missense	possibly damaging	0.51
R4895:Cluh	UTSW	11	74667405	missense	probably damaging	1.00
R5056:Cluh	UTSW	11	74661946	missense	probably damaging	1.00
R5089:Cluh	UTSW	11	74660372	missense	probably damaging	1.00
R5217:Cluh	UTSW	11	74659705	missense	probably damaging	1.00
R5346:Cluh	UTSW	11	74665218	missense	probably damaging	1.00
R5382:Cluh	UTSW	11	74665109	intron	probably benign
R5516:Cluh	UTSW	11	74660444	missense	probably damaging	1.00
R5809:Cluh	UTSW	11	74661700	missense	probably damaging	1.00
R6146:Cluh	UTSW	11	74667228	splice site	probably null
R6326:Cluh	UTSW	11	74666242	missense	probably benign	0.10
R6541:Cluh	UTSW	11	74657214	missense	probably damaging	1.00
R6870:Cluh	UTSW	11	74665384	missense	probably damaging	1.00
R6875:Cluh	UTSW	11	74661918	missense	probably damaging	1.00
R7086:Cluh	UTSW	11	74667340	missense	possibly damaging	0.46
R7225:Cluh	UTSW	11	74666406	splice site	probably null
R7310:Cluh	UTSW	11	74669459	missense	probably benign	0.10
R7317:Cluh	UTSW	11	74665704	missense	possibly damaging	0.90
R7674:Cluh	UTSW	11	74667720	missense	probably damaging	1.00
R7941:Cluh	UTSW	11	74659757	missense	probably benign	0.00
R9061:Cluh	UTSW	11	74660366	missense	possibly damaging	0.73
R9326:Cluh	UTSW	11	74664076	missense	probably benign	0.00
R9489:Cluh	UTSW	11	74667946	missense	possibly damaging	0.92
R9605:Cluh	UTSW	11	74667946	missense	possibly damaging	0.92
RF020:Cluh	UTSW	11	74669538	small insertion	probably benign
RF032:Cluh	UTSW	11	74669515	small insertion	probably benign
X0028:Cluh	UTSW	11	74663466	missense	probably benign	0.26
Z1177:Cluh	UTSW	11	74667754	missense	possibly damaging	0.82
Z1186:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1186:Cluh	UTSW	11	74669531	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669514	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669516	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669520	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669521	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669524	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669529	small insertion	probably benign
Z1188:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669514	frame shift	probably null
Z1189:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669519	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669523	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669529	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669530	nonsense	probably null
Z1189:Cluh	UTSW	11	74669531	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669518	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669530	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669532	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669514	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669523	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669526	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669530	small insertion	probably benign
Z1192:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1192:Cluh	UTSW	11	74669525	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- GTGGTCAAGCATGTCAACCC -3'
(R):5'- CATGGAAACCCATTCTCCCTG -3'

Sequencing Primer
(F):5'- TGTCAACCCCAAGGCGTC -3'
(R):5'- GAAACCCATTCTCCCTGTTTTAACAG -3'

Posted On

2018-07-23