Incidental Mutation 'R6674:Tomm20l'
ID527221
Institutional Source Beutler Lab
Gene Symbol Tomm20l
Ensembl Gene ENSMUSG00000021078
Gene Nametranslocase of outer mitochondrial membrane 20-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6674 (G1)
Quality Score158.009
Status Not validated
Chromosome12
Chromosomal Location71111428-71123221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71111533 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 30 (D30G)
Ref Sequence ENSEMBL: ENSMUSP00000021482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021482] [ENSMUST00000220834]
Predicted Effect probably damaging
Transcript: ENSMUST00000021482
AA Change: D30G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021482
Gene: ENSMUSG00000021078
AA Change: D30G

DomainStartEndE-ValueType
Pfam:MAS20 14 128 7.6e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000220834
AA Change: D30G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221962
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik T C 19: 45,974,998 E92G probably benign Het
Cluh A G 11: 74,666,227 H1005R probably damaging Het
Coro2b C T 9: 62,432,427 R13H probably damaging Het
Depdc1a T A 3: 159,526,707 N698K probably benign Het
Dusp12 G A 1: 170,879,748 T257I probably benign Het
Esf1 T A 2: 140,120,806 K782* probably null Het
Extl1 T C 4: 134,358,127 T560A probably damaging Het
Gpr179 C A 11: 97,347,405 probably null Het
Krt90 G A 15: 101,557,326 L287F probably damaging Het
Mertk T C 2: 128,729,357 V77A probably benign Het
Nr4a2 C T 2: 57,112,424 A6T probably damaging Het
Pdzd8 G A 19: 59,301,369 P533L probably damaging Het
Plxnb1 G A 9: 109,108,146 G1132R probably benign Het
Ppfia2 A G 10: 106,927,772 I1209V probably benign Het
Slc26a9 A T 1: 131,765,018 Q696L probably benign Het
Sphkap A T 1: 83,277,834 S444R probably benign Het
Tmem144 A G 3: 79,839,183 F22L possibly damaging Het
Trpc2 A G 7: 102,096,057 T827A probably benign Het
Unc50 T C 1: 37,437,458 V208A probably benign Het
Vmn1r125 T C 7: 21,272,713 S179P probably damaging Het
Vmn1r225 A C 17: 20,503,115 I273L probably benign Het
Vmn2r117 G A 17: 23,460,049 Q734* probably null Het
Vmn2r88 A G 14: 51,414,338 I378V probably benign Het
Zfp507 C T 7: 35,794,734 V295I probably damaging Het
Zfp981 A G 4: 146,535,493 R35G probably damaging Het
Other mutations in Tomm20l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03340:Tomm20l APN 12 71117614 splice site probably benign
R0544:Tomm20l UTSW 12 71123077 missense possibly damaging 0.84
R3788:Tomm20l UTSW 12 71111742 missense possibly damaging 0.93
R3789:Tomm20l UTSW 12 71111742 missense possibly damaging 0.93
R3790:Tomm20l UTSW 12 71111742 missense possibly damaging 0.93
R3962:Tomm20l UTSW 12 71117578 missense probably benign 0.31
R7148:Tomm20l UTSW 12 71117539 missense probably benign 0.00
R7545:Tomm20l UTSW 12 71117397 splice site probably null
R8281:Tomm20l UTSW 12 71111467 missense probably benign 0.18
Z1187:Tomm20l UTSW 12 71121984 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGGCTCAGAATTCCCGAGTC -3'
(R):5'- TCTAGAAGGTTCCTTGGCGG -3'

Sequencing Primer
(F):5'- AGAATTCCCGAGTCCTGGGTTC -3'
(R):5'- AGCTCTTCTCTCTGCAAACACAG -3'
Posted On2018-07-23