Mutagenetix > Incidental Mutation

Incidental Mutation 'R6674:Vmn2r117'

527225

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r117

Ensembl Gene

ENSMUSG00000091407

Gene Name

vomeronasal 2, receptor 117

Synonyms

EG619788

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R6674 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

23459675-23479597 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 23460049 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 734 (Q734*)

Ref Sequence

ENSEMBL: ENSMUSP00000126885 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000171996]

AlphaFold

K7N6V1

Predicted Effect

probably null
Transcript: ENSMUST00000171996
AA Change: Q734*

SMART Domains

Protein: ENSMUSP00000126885
Gene: ENSMUSG00000091407
AA Change: Q734*

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	471	2.6e-28	PFAM
Pfam:NCD3G	512	565	5e-20	PFAM
Pfam:7tm_3	595	833	8.2e-54	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	T	C	19: 45,974,998	E92G	probably benign	Het
Cluh	A	G	11: 74,666,227	H1005R	probably damaging	Het
Coro2b	C	T	9: 62,432,427	R13H	probably damaging	Het
Depdc1a	T	A	3: 159,526,707	N698K	probably benign	Het
Dusp12	G	A	1: 170,879,748	T257I	probably benign	Het
Esf1	T	A	2: 140,120,806	K782*	probably null	Het
Extl1	T	C	4: 134,358,127	T560A	probably damaging	Het
Gpr179	C	A	11: 97,347,405		probably null	Het
Krt90	G	A	15: 101,557,326	L287F	probably damaging	Het
Mertk	T	C	2: 128,729,357	V77A	probably benign	Het
Nr4a2	C	T	2: 57,112,424	A6T	probably damaging	Het
Pdzd8	G	A	19: 59,301,369	P533L	probably damaging	Het
Plxnb1	G	A	9: 109,108,146	G1132R	probably benign	Het
Ppfia2	A	G	10: 106,927,772	I1209V	probably benign	Het
Slc26a9	A	T	1: 131,765,018	Q696L	probably benign	Het
Sphkap	A	T	1: 83,277,834	S444R	probably benign	Het
Tmem144	A	G	3: 79,839,183	F22L	possibly damaging	Het
Tomm20l	A	G	12: 71,111,533	D30G	probably damaging	Het
Trpc2	A	G	7: 102,096,057	T827A	probably benign	Het
Unc50	T	C	1: 37,437,458	V208A	probably benign	Het
Vmn1r125	T	C	7: 21,272,713	S179P	probably damaging	Het
Vmn1r225	A	C	17: 20,503,115	I273L	probably benign	Het
Vmn2r88	A	G	14: 51,414,338	I378V	probably benign	Het
Zfp507	C	T	7: 35,794,734	V295I	probably damaging	Het
Zfp981	A	G	4: 146,535,493	R35G	probably damaging	Het

Other mutations in Vmn2r117

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Vmn2r117	APN	17	23477840	missense	probably damaging	1.00
IGL00990:Vmn2r117	APN	17	23475429	missense	probably damaging	1.00
IGL00990:Vmn2r117	APN	17	23479546	missense	probably benign
IGL01078:Vmn2r117	APN	17	23477804	missense	probably damaging	1.00
IGL01139:Vmn2r117	APN	17	23477804	missense	probably damaging	1.00
IGL01374:Vmn2r117	APN	17	23478382	missense	possibly damaging	0.46
IGL01779:Vmn2r117	APN	17	23477241	missense	probably benign	0.00
IGL02283:Vmn2r117	APN	17	23475382	missense	probably damaging	0.99
IGL02527:Vmn2r117	APN	17	23477225	missense	possibly damaging	0.65
IGL02612:Vmn2r117	APN	17	23459784	missense	possibly damaging	0.91
IGL02887:Vmn2r117	APN	17	23475578	splice site	probably benign
IGL03167:Vmn2r117	APN	17	23477707	missense	probably damaging	1.00
R0315:Vmn2r117	UTSW	17	23460165	missense	probably benign	0.11
R0610:Vmn2r117	UTSW	17	23475514	missense	probably benign	0.00
R0747:Vmn2r117	UTSW	17	23475503	nonsense	probably null
R1411:Vmn2r117	UTSW	17	23460553	missense	probably damaging	1.00
R1471:Vmn2r117	UTSW	17	23478473	missense	probably benign	0.00
R1853:Vmn2r117	UTSW	17	23477455	missense	probably damaging	0.99
R1925:Vmn2r117	UTSW	17	23478389	missense	probably benign	0.00
R1940:Vmn2r117	UTSW	17	23477480	missense	probably damaging	1.00
R2005:Vmn2r117	UTSW	17	23477644	missense	probably damaging	1.00
R2082:Vmn2r117	UTSW	17	23460256	missense	possibly damaging	0.55
R2698:Vmn2r117	UTSW	17	23459911	missense	probably damaging	0.98
R2972:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R2973:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R2974:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R3160:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3161:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3162:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3847:Vmn2r117	UTSW	17	23460415	missense	probably damaging	0.97
R3848:Vmn2r117	UTSW	17	23460415	missense	probably damaging	0.97
R4082:Vmn2r117	UTSW	17	23460106	missense	probably benign	0.00
R4320:Vmn2r117	UTSW	17	23479513	frame shift	probably null
R4560:Vmn2r117	UTSW	17	23459877	missense	probably damaging	1.00
R4658:Vmn2r117	UTSW	17	23478416	missense	probably benign	0.01
R4881:Vmn2r117	UTSW	17	23477885	missense	probably damaging	1.00
R4908:Vmn2r117	UTSW	17	23459838	missense	probably damaging	1.00
R4910:Vmn2r117	UTSW	17	23479513	frame shift	probably null
R5078:Vmn2r117	UTSW	17	23460148	missense	probably damaging	1.00
R5327:Vmn2r117	UTSW	17	23477874	nonsense	probably null
R5774:Vmn2r117	UTSW	17	23477202	missense	probably damaging	0.98
R6014:Vmn2r117	UTSW	17	23479561	missense	probably damaging	0.97
R6390:Vmn2r117	UTSW	17	23460114	missense	possibly damaging	0.95
R6520:Vmn2r117	UTSW	17	23460219	missense	probably damaging	0.99
R6736:Vmn2r117	UTSW	17	23478308	missense	probably damaging	0.99
R6909:Vmn2r117	UTSW	17	23479505	missense	possibly damaging	0.67
R6913:Vmn2r117	UTSW	17	23479563	missense	probably damaging	0.99
R7220:Vmn2r117	UTSW	17	23477203	missense	probably damaging	1.00
R7260:Vmn2r117	UTSW	17	23475385	missense	probably benign	0.06
R7440:Vmn2r117	UTSW	17	23475565	missense	probably benign	0.26
R7443:Vmn2r117	UTSW	17	23460133	missense	probably benign	0.25
R7443:Vmn2r117	UTSW	17	23460345	missense	probably damaging	1.00
R7449:Vmn2r117	UTSW	17	23459895	missense	probably damaging	1.00
R7644:Vmn2r117	UTSW	17	23477291	missense	probably damaging	0.98
R7914:Vmn2r117	UTSW	17	23460126	missense	possibly damaging	0.95
R8001:Vmn2r117	UTSW	17	23479407	missense	possibly damaging	0.89
R8029:Vmn2r117	UTSW	17	23477770	missense	probably benign	0.00
R8340:Vmn2r117	UTSW	17	23460537	missense	probably benign	0.01
R8519:Vmn2r117	UTSW	17	23479468	missense	probably benign
R8723:Vmn2r117	UTSW	17	23477369	missense	probably damaging	1.00
R8914:Vmn2r117	UTSW	17	23460169	missense	probably benign	0.02
R9010:Vmn2r117	UTSW	17	23460471	missense	probably benign	0.10
R9129:Vmn2r117	UTSW	17	23459944	nonsense	probably null
R9244:Vmn2r117	UTSW	17	23477615	missense	probably damaging	0.98
R9464:Vmn2r117	UTSW	17	23477604	missense	probably benign	0.23
R9620:Vmn2r117	UTSW	17	23478476	missense	probably damaging	0.97
V5622:Vmn2r117	UTSW	17	23477840	missense	probably damaging	1.00
V5622:Vmn2r117	UTSW	17	23479505	missense	possibly damaging	0.67
Z1176:Vmn2r117	UTSW	17	23459766	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CATGACCTTGCCTTTGGTGC -3'
(R):5'- TCCACTGTCTTGGCTAAAACG -3'

Sequencing Primer
(F):5'- GCCTTTGGTGCTATAGTAAACAG -3'
(R):5'- CCACTGTCTTGGCTAAAACGATTAC -3'

Posted On

2018-07-23