Mutagenetix > Incidental Mutation

Incidental Mutation 'R6674:Pdzd8'

527227

Institutional Source

Beutler Lab

Gene Symbol

Pdzd8

Ensembl Gene

ENSMUSG00000074746

Gene Name

PDZ domain containing 8

Synonyms

A630041P07Rik, Pdzk8

MMRRC Submission

044794-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6674 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

59296084-59345780 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 59301369 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 533 (P533L)

Ref Sequence

ENSEMBL: ENSMUSP00000096880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099274]

AlphaFold

B9EJ80

Predicted Effect

probably damaging
Transcript: ENSMUST00000099274
AA Change: P533L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000096880
Gene: ENSMUSG00000074746
AA Change: P533L

Domain	Start	End	E-Value	Type
transmembrane domain	2	24	N/A	INTRINSIC
low complexity region	75	90	N/A	INTRINSIC
PDZ	374	448	2.02e-10	SMART
low complexity region	582	596	N/A	INTRINSIC
low complexity region	802	814	N/A	INTRINSIC
C1	834	884	8.31e-8	SMART
coiled coil region	1021	1057	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	T	C	19: 45,974,998	E92G	probably benign	Het
Cluh	A	G	11: 74,666,227	H1005R	probably damaging	Het
Coro2b	C	T	9: 62,432,427	R13H	probably damaging	Het
Depdc1a	T	A	3: 159,526,707	N698K	probably benign	Het
Dusp12	G	A	1: 170,879,748	T257I	probably benign	Het
Esf1	T	A	2: 140,120,806	K782*	probably null	Het
Extl1	T	C	4: 134,358,127	T560A	probably damaging	Het
Gpr179	C	A	11: 97,347,405		probably null	Het
Krt90	G	A	15: 101,557,326	L287F	probably damaging	Het
Mertk	T	C	2: 128,729,357	V77A	probably benign	Het
Nr4a2	C	T	2: 57,112,424	A6T	probably damaging	Het
Plxnb1	G	A	9: 109,108,146	G1132R	probably benign	Het
Ppfia2	A	G	10: 106,927,772	I1209V	probably benign	Het
Slc26a9	A	T	1: 131,765,018	Q696L	probably benign	Het
Sphkap	A	T	1: 83,277,834	S444R	probably benign	Het
Tmem144	A	G	3: 79,839,183	F22L	possibly damaging	Het
Tomm20l	A	G	12: 71,111,533	D30G	probably damaging	Het
Trpc2	A	G	7: 102,096,057	T827A	probably benign	Het
Unc50	T	C	1: 37,437,458	V208A	probably benign	Het
Vmn1r125	T	C	7: 21,272,713	S179P	probably damaging	Het
Vmn1r225	A	C	17: 20,503,115	I273L	probably benign	Het
Vmn2r117	G	A	17: 23,460,049	Q734*	probably null	Het
Vmn2r88	A	G	14: 51,414,338	I378V	probably benign	Het
Zfp507	C	T	7: 35,794,734	V295I	probably damaging	Het
Zfp981	A	G	4: 146,535,493	R35G	probably damaging	Het

Other mutations in Pdzd8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01293:Pdzd8	APN	19	59299786	missense	probably damaging	1.00
IGL01321:Pdzd8	APN	19	59301529	missense	probably benign
IGL01865:Pdzd8	APN	19	59299645	missense	possibly damaging	0.92
IGL02044:Pdzd8	APN	19	59315292	missense	possibly damaging	0.85
IGL02119:Pdzd8	APN	19	59300490	missense	possibly damaging	0.95
IGL02186:Pdzd8	APN	19	59300628	missense	probably damaging	1.00
IGL02389:Pdzd8	APN	19	59301393	missense	probably benign	0.00
IGL02479:Pdzd8	APN	19	59299783	nonsense	probably null
IGL02713:Pdzd8	APN	19	59345458	missense	probably damaging	0.98
IGL02958:Pdzd8	APN	19	59300372	nonsense	probably null
IGL02966:Pdzd8	APN	19	59300859	missense	probably damaging	1.00
IGL03166:Pdzd8	APN	19	59300508	missense	probably damaging	1.00
citadel	UTSW	19	59299525	makesense	probably null
Eleventh_hour	UTSW	19	59305230	missense	probably damaging	1.00
keep	UTSW	19	59301351	nonsense	probably null
Stronghold	UTSW	19	59345352	nonsense	probably null
R0018:Pdzd8	UTSW	19	59300673	missense	probably damaging	1.00
R0038:Pdzd8	UTSW	19	59299596	missense	possibly damaging	0.54
R0196:Pdzd8	UTSW	19	59301131	missense	probably benign	0.00
R0233:Pdzd8	UTSW	19	59300379	missense	probably damaging	0.99
R0233:Pdzd8	UTSW	19	59300379	missense	probably damaging	0.99
R0418:Pdzd8	UTSW	19	59300929	missense	probably damaging	1.00
R0736:Pdzd8	UTSW	19	59344933	missense	probably damaging	0.99
R1456:Pdzd8	UTSW	19	59300472	missense	probably benign	0.01
R1709:Pdzd8	UTSW	19	59301339	missense	probably benign
R1965:Pdzd8	UTSW	19	59300122	missense	probably benign	0.37
R2155:Pdzd8	UTSW	19	59300421	missense	probably damaging	1.00
R3077:Pdzd8	UTSW	19	59305156	critical splice donor site	probably null
R3411:Pdzd8	UTSW	19	59345413	missense	probably damaging	1.00
R4345:Pdzd8	UTSW	19	59300128	missense	probably benign	0.00
R4354:Pdzd8	UTSW	19	59345481	missense	probably benign
R4504:Pdzd8	UTSW	19	59345448	missense	probably damaging	1.00
R4642:Pdzd8	UTSW	19	59305230	missense	probably damaging	1.00
R4705:Pdzd8	UTSW	19	59345311	missense	possibly damaging	0.80
R4773:Pdzd8	UTSW	19	59300860	missense	probably damaging	1.00
R4876:Pdzd8	UTSW	19	59300804	nonsense	probably null
R5176:Pdzd8	UTSW	19	59344957	missense	probably damaging	1.00
R5267:Pdzd8	UTSW	19	59301026	missense	probably damaging	1.00
R5707:Pdzd8	UTSW	19	59299625	missense	probably benign	0.00
R5766:Pdzd8	UTSW	19	59300540	missense	possibly damaging	0.65
R5903:Pdzd8	UTSW	19	59345286	missense	possibly damaging	0.58
R6036:Pdzd8	UTSW	19	59305209	missense	probably damaging	1.00
R6036:Pdzd8	UTSW	19	59305209	missense	probably damaging	1.00
R6238:Pdzd8	UTSW	19	59300562	missense	probably benign	0.05
R6360:Pdzd8	UTSW	19	59300983	missense	probably benign	0.10
R6509:Pdzd8	UTSW	19	59344866	missense	probably benign	0.01
R6808:Pdzd8	UTSW	19	59299525	makesense	probably null
R6902:Pdzd8	UTSW	19	59301397	missense	possibly damaging	0.91
R7017:Pdzd8	UTSW	19	59345352	nonsense	probably null
R7088:Pdzd8	UTSW	19	59344957	missense	probably damaging	1.00
R7116:Pdzd8	UTSW	19	59299693	missense	probably damaging	1.00
R7158:Pdzd8	UTSW	19	59300157	missense	probably damaging	1.00
R7237:Pdzd8	UTSW	19	59345139	missense	probably damaging	1.00
R7251:Pdzd8	UTSW	19	59300645	missense	possibly damaging	0.96
R7314:Pdzd8	UTSW	19	59301351	nonsense	probably null
R7699:Pdzd8	UTSW	19	59344941	missense	probably damaging	1.00
R7751:Pdzd8	UTSW	19	59344776	missense	probably damaging	0.98
R7759:Pdzd8	UTSW	19	59299926	missense	probably damaging	1.00
R7784:Pdzd8	UTSW	19	59327863	missense	probably damaging	1.00
R7917:Pdzd8	UTSW	19	59345086	missense	probably damaging	0.96
R9364:Pdzd8	UTSW	19	59345142	missense	probably damaging	1.00
R9368:Pdzd8	UTSW	19	59300787	nonsense	probably null
R9406:Pdzd8	UTSW	19	59344813	missense
R9548:Pdzd8	UTSW	19	59301394	missense	probably benign	0.13
R9554:Pdzd8	UTSW	19	59345142	missense	probably damaging	1.00
R9688:Pdzd8	UTSW	19	59345251	missense	probably benign	0.05
R9750:Pdzd8	UTSW	19	59301252	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAGGTTTATCTGCAGGAGGAG -3'
(R):5'- AAAGCTTCTTGTCCAGCTCCTG -3'

Sequencing Primer
(F):5'- AGGGAGCAGCACCTTGTCTG -3'
(R):5'- CTACGAAGAGGACGCTGCTG -3'

Posted On

2018-07-23