Incidental Mutation 'R6674:Pdzd8'
ID527227
Institutional Source Beutler Lab
Gene Symbol Pdzd8
Ensembl Gene ENSMUSG00000074746
Gene NamePDZ domain containing 8
SynonymsA630041P07Rik, Pdzk8
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6674 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location59296084-59345780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59301369 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 533 (P533L)
Ref Sequence ENSEMBL: ENSMUSP00000096880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099274]
Predicted Effect probably damaging
Transcript: ENSMUST00000099274
AA Change: P533L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096880
Gene: ENSMUSG00000074746
AA Change: P533L

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
PDZ 374 448 2.02e-10 SMART
low complexity region 582 596 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
C1 834 884 8.31e-8 SMART
coiled coil region 1021 1057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik T C 19: 45,974,998 E92G probably benign Het
Cluh A G 11: 74,666,227 H1005R probably damaging Het
Coro2b C T 9: 62,432,427 R13H probably damaging Het
Depdc1a T A 3: 159,526,707 N698K probably benign Het
Dusp12 G A 1: 170,879,748 T257I probably benign Het
Esf1 T A 2: 140,120,806 K782* probably null Het
Extl1 T C 4: 134,358,127 T560A probably damaging Het
Gpr179 C A 11: 97,347,405 probably null Het
Krt90 G A 15: 101,557,326 L287F probably damaging Het
Mertk T C 2: 128,729,357 V77A probably benign Het
Nr4a2 C T 2: 57,112,424 A6T probably damaging Het
Plxnb1 G A 9: 109,108,146 G1132R probably benign Het
Ppfia2 A G 10: 106,927,772 I1209V probably benign Het
Slc26a9 A T 1: 131,765,018 Q696L probably benign Het
Sphkap A T 1: 83,277,834 S444R probably benign Het
Tmem144 A G 3: 79,839,183 F22L possibly damaging Het
Tomm20l A G 12: 71,111,533 D30G probably damaging Het
Trpc2 A G 7: 102,096,057 T827A probably benign Het
Unc50 T C 1: 37,437,458 V208A probably benign Het
Vmn1r125 T C 7: 21,272,713 S179P probably damaging Het
Vmn1r225 A C 17: 20,503,115 I273L probably benign Het
Vmn2r117 G A 17: 23,460,049 Q734* probably null Het
Vmn2r88 A G 14: 51,414,338 I378V probably benign Het
Zfp507 C T 7: 35,794,734 V295I probably damaging Het
Zfp981 A G 4: 146,535,493 R35G probably damaging Het
Other mutations in Pdzd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Pdzd8 APN 19 59299786 missense probably damaging 1.00
IGL01321:Pdzd8 APN 19 59301529 missense probably benign
IGL01865:Pdzd8 APN 19 59299645 missense possibly damaging 0.92
IGL02044:Pdzd8 APN 19 59315292 missense possibly damaging 0.85
IGL02119:Pdzd8 APN 19 59300490 missense possibly damaging 0.95
IGL02186:Pdzd8 APN 19 59300628 missense probably damaging 1.00
IGL02389:Pdzd8 APN 19 59301393 missense probably benign 0.00
IGL02479:Pdzd8 APN 19 59299783 nonsense probably null
IGL02713:Pdzd8 APN 19 59345458 missense probably damaging 0.98
IGL02958:Pdzd8 APN 19 59300372 nonsense probably null
IGL02966:Pdzd8 APN 19 59300859 missense probably damaging 1.00
IGL03166:Pdzd8 APN 19 59300508 missense probably damaging 1.00
citadel UTSW 19 59299525 makesense probably null
Eleventh_hour UTSW 19 59305230 missense probably damaging 1.00
keep UTSW 19 59301351 nonsense probably null
Stronghold UTSW 19 59345352 nonsense probably null
R0018:Pdzd8 UTSW 19 59300673 missense probably damaging 1.00
R0038:Pdzd8 UTSW 19 59299596 missense possibly damaging 0.54
R0196:Pdzd8 UTSW 19 59301131 missense probably benign 0.00
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0418:Pdzd8 UTSW 19 59300929 missense probably damaging 1.00
R0736:Pdzd8 UTSW 19 59344933 missense probably damaging 0.99
R1456:Pdzd8 UTSW 19 59300472 missense probably benign 0.01
R1709:Pdzd8 UTSW 19 59301339 missense probably benign
R1965:Pdzd8 UTSW 19 59300122 missense probably benign 0.37
R2155:Pdzd8 UTSW 19 59300421 missense probably damaging 1.00
R3077:Pdzd8 UTSW 19 59305156 critical splice donor site probably null
R3411:Pdzd8 UTSW 19 59345413 missense probably damaging 1.00
R4345:Pdzd8 UTSW 19 59300128 missense probably benign 0.00
R4354:Pdzd8 UTSW 19 59345481 missense probably benign
R4504:Pdzd8 UTSW 19 59345448 missense probably damaging 1.00
R4642:Pdzd8 UTSW 19 59305230 missense probably damaging 1.00
R4705:Pdzd8 UTSW 19 59345311 missense possibly damaging 0.80
R4773:Pdzd8 UTSW 19 59300860 missense probably damaging 1.00
R4876:Pdzd8 UTSW 19 59300804 nonsense probably null
R5176:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R5267:Pdzd8 UTSW 19 59301026 missense probably damaging 1.00
R5707:Pdzd8 UTSW 19 59299625 missense probably benign 0.00
R5766:Pdzd8 UTSW 19 59300540 missense possibly damaging 0.65
R5903:Pdzd8 UTSW 19 59345286 missense possibly damaging 0.58
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6238:Pdzd8 UTSW 19 59300562 missense probably benign 0.05
R6360:Pdzd8 UTSW 19 59300983 missense probably benign 0.10
R6509:Pdzd8 UTSW 19 59344866 missense probably benign 0.01
R6808:Pdzd8 UTSW 19 59299525 makesense probably null
R6902:Pdzd8 UTSW 19 59301397 missense possibly damaging 0.91
R7017:Pdzd8 UTSW 19 59345352 nonsense probably null
R7088:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R7116:Pdzd8 UTSW 19 59299693 missense probably damaging 1.00
R7158:Pdzd8 UTSW 19 59300157 missense probably damaging 1.00
R7237:Pdzd8 UTSW 19 59345139 missense probably damaging 1.00
R7251:Pdzd8 UTSW 19 59300645 missense possibly damaging 0.96
R7314:Pdzd8 UTSW 19 59301351 nonsense probably null
R7699:Pdzd8 UTSW 19 59344941 missense probably damaging 1.00
R7751:Pdzd8 UTSW 19 59344776 missense probably damaging 0.98
R7759:Pdzd8 UTSW 19 59299926 missense probably damaging 1.00
R7784:Pdzd8 UTSW 19 59327863 missense probably damaging 1.00
R7917:Pdzd8 UTSW 19 59345086 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGGTTTATCTGCAGGAGGAG -3'
(R):5'- AAAGCTTCTTGTCCAGCTCCTG -3'

Sequencing Primer
(F):5'- AGGGAGCAGCACCTTGTCTG -3'
(R):5'- CTACGAAGAGGACGCTGCTG -3'
Posted On2018-07-23