Incidental Mutation 'R6675:Ncapg2'
ID527259
Institutional Source Beutler Lab
Gene Symbol Ncapg2
Ensembl Gene ENSMUSG00000042029
Gene Namenon-SMC condensin II complex, subunit G2
SynonymsLuzp5, 5830426I05Rik, mCAP-G2, Mtb
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6675 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location116405402-116463731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 116434661 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 627 (K627N)
Ref Sequence ENSEMBL: ENSMUSP00000081889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084828]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084828
AA Change: K627N

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081889
Gene: ENSMUSG00000042029
AA Change: K627N

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Condensin2nSMC 212 361 7.2e-62 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Condensin2nSMC family of proteins. The encoded protein is a regulatory subunit of the condensin II complex which, along with the condensin I complex, plays a role in chromosome assembly and segregation during mitosis. A similar protein in mouse is required for early development of the embryo. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null embryos exhibit impaired inner cell mass expansion and die shortly after implantation and prior to gastrulation and blood cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,115,476 T1268A probably benign Het
Adamts20 A G 15: 94,331,316 probably null Het
Arhgap45 G T 10: 80,018,104 D151Y probably null Het
Arhgef40 C A 14: 51,991,641 L592I probably damaging Het
Ascc3 G T 10: 50,750,563 E1720* probably null Het
Atp2c1 C T 9: 105,453,533 probably null Het
Avpi1 G A 19: 42,123,744 P125L probably benign Het
Cers3 A T 7: 66,786,096 T232S possibly damaging Het
Cfap53 T C 18: 74,307,376 probably null Het
Col4a3 T C 1: 82,668,925 S386P unknown Het
Dhtkd1 A T 2: 5,904,078 M735K probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Gad2 T C 2: 22,673,985 V400A possibly damaging Het
Gm10801 TC TCGCC 2: 98,663,806 probably benign Het
Gm13103 G A 4: 143,853,258 C471Y probably damaging Het
Hmgxb3 T G 18: 61,137,576 D892A possibly damaging Het
Hsd3b2 G A 3: 98,713,472 T89I probably benign Het
Iars C A 13: 49,719,578 A713D probably damaging Het
Itih1 G A 14: 30,929,841 T848I possibly damaging Het
Kcne2 A G 16: 92,296,624 D13G probably benign Het
Klra17 T A 6: 129,872,323 N96I probably damaging Het
Lrig2 T C 3: 104,457,935 N634D probably benign Het
Mrc2 T A 11: 105,343,080 probably null Het
Mroh3 A T 1: 136,190,812 S558T possibly damaging Het
Ncstn A T 1: 172,071,528 D345E probably damaging Het
Nkx1-1 G T 5: 33,433,879 A33E unknown Het
Olfr134 T A 17: 38,176,014 M310K probably benign Het
Olfr568 A G 7: 102,877,273 E51G possibly damaging Het
Osbpl9 G T 4: 109,133,828 probably null Het
P2rx6 T C 16: 17,562,168 V52A probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Pdk2 T C 11: 95,028,742 I273V probably benign Het
Pdpr C T 8: 111,101,900 Q12* probably null Het
Plxdc2 A G 2: 16,712,121 T339A probably benign Het
Retsat T C 6: 72,601,689 V128A probably benign Het
Rnf17 A G 14: 56,459,975 E442G probably damaging Het
Sec31b T C 19: 44,523,775 N560S probably benign Het
Slc22a16 C T 10: 40,573,840 Q91* probably null Het
Slc24a5 G T 2: 125,080,695 A126S possibly damaging Het
Slc26a4 A T 12: 31,540,513 D380E possibly damaging Het
Stc2 T A 11: 31,360,307 D243V probably benign Het
Tshz2 G T 2: 169,886,045 A385S probably damaging Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vmn1r77 A G 7: 12,041,455 T53A probably damaging Het
Zeb2 A T 2: 44,997,445 Y518* probably null Het
Zfp760 T A 17: 21,723,010 S389T possibly damaging Het
Other mutations in Ncapg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Ncapg2 APN 12 116424650 missense possibly damaging 0.54
IGL01694:Ncapg2 APN 12 116407230 utr 5 prime probably benign
IGL01724:Ncapg2 APN 12 116426711 missense probably damaging 1.00
IGL01792:Ncapg2 APN 12 116425818 missense probably damaging 0.99
IGL02098:Ncapg2 APN 12 116444332 missense possibly damaging 0.59
IGL02136:Ncapg2 APN 12 116460583 missense probably benign
IGL02409:Ncapg2 APN 12 116420717 missense probably damaging 1.00
IGL02580:Ncapg2 APN 12 116420689 missense probably damaging 1.00
IGL02653:Ncapg2 APN 12 116425906 critical splice donor site probably null
IGL03073:Ncapg2 APN 12 116452274 missense probably benign 0.01
IGL03114:Ncapg2 APN 12 116452373 splice site probably benign
IGL03199:Ncapg2 APN 12 116419236 missense probably damaging 1.00
IGL03328:Ncapg2 APN 12 116440057 missense possibly damaging 0.90
P0033:Ncapg2 UTSW 12 116438635 missense probably benign 0.03
R0008:Ncapg2 UTSW 12 116429835 missense probably damaging 1.00
R0194:Ncapg2 UTSW 12 116420683 splice site probably null
R0379:Ncapg2 UTSW 12 116443075 missense probably damaging 1.00
R0568:Ncapg2 UTSW 12 116423215 missense probably damaging 1.00
R0771:Ncapg2 UTSW 12 116413159 nonsense probably null
R1016:Ncapg2 UTSW 12 116438675 missense probably damaging 1.00
R1507:Ncapg2 UTSW 12 116460566 missense probably benign 0.00
R1524:Ncapg2 UTSW 12 116434578 splice site probably benign
R1596:Ncapg2 UTSW 12 116419236 missense probably damaging 1.00
R1635:Ncapg2 UTSW 12 116434685 frame shift probably null
R1752:Ncapg2 UTSW 12 116426718 missense probably damaging 1.00
R2164:Ncapg2 UTSW 12 116450475 splice site probably null
R2266:Ncapg2 UTSW 12 116429676 missense probably damaging 1.00
R2366:Ncapg2 UTSW 12 116420729 nonsense probably null
R2924:Ncapg2 UTSW 12 116438729 missense probably benign 0.03
R2925:Ncapg2 UTSW 12 116438729 missense probably benign 0.03
R3828:Ncapg2 UTSW 12 116407318 splice site probably benign
R3829:Ncapg2 UTSW 12 116407318 splice site probably benign
R4384:Ncapg2 UTSW 12 116439877 critical splice donor site probably null
R4651:Ncapg2 UTSW 12 116425787 missense probably damaging 1.00
R4701:Ncapg2 UTSW 12 116440618 missense probably benign
R4821:Ncapg2 UTSW 12 116415457 missense probably damaging 0.99
R4845:Ncapg2 UTSW 12 116440588 missense probably damaging 0.96
R5135:Ncapg2 UTSW 12 116427786 missense possibly damaging 0.64
R5294:Ncapg2 UTSW 12 116427794 missense possibly damaging 0.54
R5334:Ncapg2 UTSW 12 116426637 missense probably damaging 1.00
R5588:Ncapg2 UTSW 12 116413077 missense possibly damaging 0.95
R5888:Ncapg2 UTSW 12 116425800 missense possibly damaging 0.84
R5938:Ncapg2 UTSW 12 116429657 missense probably damaging 1.00
R5978:Ncapg2 UTSW 12 116424671 missense possibly damaging 0.68
R6016:Ncapg2 UTSW 12 116426607 missense probably damaging 1.00
R6026:Ncapg2 UTSW 12 116443021 missense possibly damaging 0.73
R6155:Ncapg2 UTSW 12 116438011 missense possibly damaging 0.83
R6509:Ncapg2 UTSW 12 116427756 missense probably damaging 1.00
R6912:Ncapg2 UTSW 12 116426582 missense probably benign
R7069:Ncapg2 UTSW 12 116424717 splice site probably null
R7339:Ncapg2 UTSW 12 116414834 missense probably damaging 0.96
R7440:Ncapg2 UTSW 12 116450413 missense possibly damaging 0.89
R7445:Ncapg2 UTSW 12 116419268 missense possibly damaging 0.50
R7704:Ncapg2 UTSW 12 116419277 missense probably damaging 1.00
R8061:Ncapg2 UTSW 12 116426577 missense probably benign
R8132:Ncapg2 UTSW 12 116444347 missense possibly damaging 0.93
R8166:Ncapg2 UTSW 12 116412416 missense probably benign 0.00
X0020:Ncapg2 UTSW 12 116424707 missense probably damaging 1.00
Z1177:Ncapg2 UTSW 12 116438605 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATTCCTAGTCTAGTTAGGTTCTAAGG -3'
(R):5'- CGCTGTATATACAAGGCAGAAC -3'

Sequencing Primer
(F):5'- GAGCTGTGCTTTAGGACTT -3'
(R):5'- AGGCAGAACTTCTCCTAAAGATG -3'
Posted On2018-07-23