Incidental Mutation 'R6675:Adamts20'
ID527264
Institutional Source Beutler Lab
Gene Symbol Adamts20
Ensembl Gene ENSMUSG00000022449
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
SynonymsADAMTS-20, bt
Accession Numbers

Genbank: NM_177431; MGI: 2660628

Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R6675 (G1)
Quality Score157.009
Status Not validated
Chromosome15
Chromosomal Location94270163-94465418 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 94331316 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035342] [ENSMUST00000155907]
Predicted Effect probably null
Transcript: ENSMUST00000035342
SMART Domains Protein: ENSMUSP00000036330
Gene: ENSMUSG00000022449

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 1.4e-30 PFAM
Pfam:Reprolysin_5 253 445 3.6e-13 PFAM
Pfam:Reprolysin_4 253 460 1.1e-7 PFAM
Pfam:Reprolysin 255 464 1.5e-26 PFAM
Pfam:Reprolysin_2 272 454 1.8e-10 PFAM
Pfam:Reprolysin_3 276 410 5.8e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2.6e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
TSP1 1416 1470 1.69e-2 SMART
TSP1 1471 1526 2.3e0 SMART
TSP1 1530 1579 1.23e0 SMART
TSP1 1653 1706 5.27e-4 SMART
Pfam:GON 1708 1905 5.8e-80 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000155907
SMART Domains Protein: ENSMUSP00000121696
Gene: ENSMUSG00000022449

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 186 1e-31 PFAM
Pfam:Reprolysin_5 253 445 2.7e-13 PFAM
Pfam:Reprolysin_4 253 460 7.2e-8 PFAM
Pfam:Reprolysin 255 464 2.4e-28 PFAM
Pfam:Reprolysin_2 272 454 4e-10 PFAM
Pfam:Reprolysin_3 276 410 1.1e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Certain mutations in this gene cause defective development of neural crest-derived melanoblasts resulting in a "belted" phenotype that is characterized by white spots in the lumbar region. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for spontaneous or ENU-induced mutations exhibit abnormal coat/hair pigmentation, including a typical white belt phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(17) : Targeted, other(1) Spontaneous(11) Chemically induced(5)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,115,476 T1268A probably benign Het
Arhgap45 G T 10: 80,018,104 D151Y probably null Het
Arhgef40 C A 14: 51,991,641 L592I probably damaging Het
Ascc3 G T 10: 50,750,563 E1720* probably null Het
Atp2c1 C T 9: 105,453,533 probably null Het
Avpi1 G A 19: 42,123,744 P125L probably benign Het
Cers3 A T 7: 66,786,096 T232S possibly damaging Het
Cfap53 T C 18: 74,307,376 probably null Het
Col4a3 T C 1: 82,668,925 S386P unknown Het
Dhtkd1 A T 2: 5,904,078 M735K probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Gad2 T C 2: 22,673,985 V400A possibly damaging Het
Gm10801 TC TCGCC 2: 98,663,806 probably benign Het
Gm13103 G A 4: 143,853,258 C471Y probably damaging Het
Hmgxb3 T G 18: 61,137,576 D892A possibly damaging Het
Hsd3b2 G A 3: 98,713,472 T89I probably benign Het
Iars C A 13: 49,719,578 A713D probably damaging Het
Itih1 G A 14: 30,929,841 T848I possibly damaging Het
Kcne2 A G 16: 92,296,624 D13G probably benign Het
Klra17 T A 6: 129,872,323 N96I probably damaging Het
Lrig2 T C 3: 104,457,935 N634D probably benign Het
Mrc2 T A 11: 105,343,080 probably null Het
Mroh3 A T 1: 136,190,812 S558T possibly damaging Het
Ncapg2 G T 12: 116,434,661 K627N possibly damaging Het
Ncstn A T 1: 172,071,528 D345E probably damaging Het
Nkx1-1 G T 5: 33,433,879 A33E unknown Het
Olfr134 T A 17: 38,176,014 M310K probably benign Het
Olfr568 A G 7: 102,877,273 E51G possibly damaging Het
Osbpl9 G T 4: 109,133,828 probably null Het
P2rx6 T C 16: 17,562,168 V52A probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Pdk2 T C 11: 95,028,742 I273V probably benign Het
Pdpr C T 8: 111,101,900 Q12* probably null Het
Plxdc2 A G 2: 16,712,121 T339A probably benign Het
Retsat T C 6: 72,601,689 V128A probably benign Het
Rnf17 A G 14: 56,459,975 E442G probably damaging Het
Sec31b T C 19: 44,523,775 N560S probably benign Het
Slc22a16 C T 10: 40,573,840 Q91* probably null Het
Slc24a5 G T 2: 125,080,695 A126S possibly damaging Het
Slc26a4 A T 12: 31,540,513 D380E possibly damaging Het
Stc2 T A 11: 31,360,307 D243V probably benign Het
Tshz2 G T 2: 169,886,045 A385S probably damaging Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vmn1r77 A G 7: 12,041,455 T53A probably damaging Het
Zeb2 A T 2: 44,997,445 Y518* probably null Het
Zfp760 T A 17: 21,723,010 S389T possibly damaging Het
Other mutations in Adamts20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Adamts20 APN 15 94394641 missense probably benign
IGL00491:Adamts20 APN 15 94273232 missense possibly damaging 0.89
IGL00502:Adamts20 APN 15 94403397 missense probably damaging 0.99
IGL00672:Adamts20 APN 15 94341105 missense probably damaging 0.99
IGL00840:Adamts20 APN 15 94282482 missense probably damaging 1.00
IGL00909:Adamts20 APN 15 94379813 missense probably damaging 1.00
IGL01101:Adamts20 APN 15 94344042 missense probably damaging 1.00
IGL01137:Adamts20 APN 15 94394611 critical splice donor site probably null
IGL01457:Adamts20 APN 15 94331448 missense probably damaging 0.97
IGL01685:Adamts20 APN 15 94403446 missense possibly damaging 0.81
IGL01949:Adamts20 APN 15 94326106 missense probably benign 0.08
IGL02525:Adamts20 APN 15 94283078 splice site probably null
IGL03088:Adamts20 APN 15 94329914 critical splice donor site probably null
IGL03175:Adamts20 APN 15 94273255 nonsense probably null
belt UTSW 15 94345990 missense probably damaging 1.00
buckeye UTSW 15 94341087 missense probably damaging 1.00
jack_white UTSW 15 unclassified
Meowth UTSW 15 94331458 missense probably damaging 1.00
nidoking UTSW 15 94403445 missense probably damaging 1.00
panda UTSW 15 94326699 intron probably benign
pikachu UTSW 15 94345990 missense probably damaging 1.00
poliwag UTSW 15 94394622 nonsense probably null
splotch2 UTSW 15 94335561 intron probably benign
wash UTSW 15 94347670 nonsense probably null
whitebelly UTSW 15 unclassified
whopper UTSW 15 94347810 missense probably damaging 1.00
R0483:Adamts20 UTSW 15 94353571 missense probably benign 0.00
R0514:Adamts20 UTSW 15 94270376 missense probably damaging 1.00
R0568:Adamts20 UTSW 15 94291713 splice site probably benign
R0730:Adamts20 UTSW 15 94347690 missense probably benign 0.00
R0973:Adamts20 UTSW 15 94286371 missense probably benign 0.00
R1339:Adamts20 UTSW 15 94322896 missense probably benign 0.19
R1721:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1809:Adamts20 UTSW 15 94341087 missense probably damaging 1.00
R1832:Adamts20 UTSW 15 94286344 missense probably benign 0.00
R1846:Adamts20 UTSW 15 94345990 missense probably damaging 1.00
R1867:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1875:Adamts20 UTSW 15 94331396 missense probably benign 0.01
R1930:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1931:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1932:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R2001:Adamts20 UTSW 15 94347718 missense possibly damaging 0.96
R2116:Adamts20 UTSW 15 94355362 missense probably damaging 1.00
R2162:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R2350:Adamts20 UTSW 15 94283916 missense probably damaging 1.00
R2887:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2889:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2890:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R3109:Adamts20 UTSW 15 94345904 splice site probably benign
R3719:Adamts20 UTSW 15 94361838 missense probably damaging 0.99
R3832:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R3901:Adamts20 UTSW 15 94328845 missense possibly damaging 0.81
R4398:Adamts20 UTSW 15 94333695 missense possibly damaging 0.93
R4402:Adamts20 UTSW 15 94379946 missense probably benign
R4431:Adamts20 UTSW 15 94344043 missense probably damaging 1.00
R4479:Adamts20 UTSW 15 94403445 missense probably damaging 1.00
R4482:Adamts20 UTSW 15 94345920 missense probably damaging 1.00
R4503:Adamts20 UTSW 15 94379750 missense probably damaging 0.99
R4671:Adamts20 UTSW 15 94403325 missense possibly damaging 0.48
R4700:Adamts20 UTSW 15 94394622 nonsense probably null
R4707:Adamts20 UTSW 15 94333647 missense possibly damaging 0.53
R4725:Adamts20 UTSW 15 94351762 missense probably damaging 0.99
R4771:Adamts20 UTSW 15 94351635 splice site probably null
R4829:Adamts20 UTSW 15 94326396 missense probably benign 0.01
R4937:Adamts20 UTSW 15 94379775 missense probably benign
R4960:Adamts20 UTSW 15 94379774 missense probably benign
R5270:Adamts20 UTSW 15 94282519 missense probably benign 0.00
R5388:Adamts20 UTSW 15 94345778 missense possibly damaging 0.81
R5410:Adamts20 UTSW 15 94281957 missense possibly damaging 0.94
R5453:Adamts20 UTSW 15 94326088 missense possibly damaging 0.69
R5611:Adamts20 UTSW 15 94273280 missense possibly damaging 0.65
R5687:Adamts20 UTSW 15 94325971 missense probably benign 0.36
R5758:Adamts20 UTSW 15 94394650 missense probably benign 0.00
R5801:Adamts20 UTSW 15 94347670 nonsense probably null
R5834:Adamts20 UTSW 15 94353584 missense probably damaging 0.99
R5993:Adamts20 UTSW 15 94338723 missense probably damaging 0.99
R5997:Adamts20 UTSW 15 94379747 missense probably damaging 1.00
R6044:Adamts20 UTSW 15 94282483 missense probably damaging 1.00
R6058:Adamts20 UTSW 15 94330047 nonsense probably null
R6217:Adamts20 UTSW 15 94338715 missense probably benign 0.00
R6283:Adamts20 UTSW 15 94351721 missense probably benign
R6354:Adamts20 UTSW 15 94347810 missense probably damaging 1.00
R6415:Adamts20 UTSW 15 94324659 critical splice donor site probably null
R6419:Adamts20 UTSW 15 94333675 missense possibly damaging 0.84
R6476:Adamts20 UTSW 15 94361810 missense probably benign 0.22
R6485:Adamts20 UTSW 15 94343971 missense probably benign 0.17
R6517:Adamts20 UTSW 15 94283104 intron probably null
R6863:Adamts20 UTSW 15 94379746 nonsense probably null
R7186:Adamts20 UTSW 15 94322808 missense possibly damaging 0.76
R7263:Adamts20 UTSW 15 94322891 missense possibly damaging 0.52
R7441:Adamts20 UTSW 15 94353673 missense probably damaging 1.00
R7519:Adamts20 UTSW 15 94325988 missense possibly damaging 0.64
R7747:Adamts20 UTSW 15 94291587 nonsense probably null
R7770:Adamts20 UTSW 15 94333698 missense probably benign 0.02
R7816:Adamts20 UTSW 15 94322844 missense probably benign 0.00
R7827:Adamts20 UTSW 15 94325933 missense probably damaging 1.00
R7853:Adamts20 UTSW 15 94345990 missense probably damaging 1.00
R7894:Adamts20 UTSW 15 94351760 missense probably damaging 1.00
R7936:Adamts20 UTSW 15 94345990 missense probably damaging 1.00
R7977:Adamts20 UTSW 15 94351760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGTCTTGTCACCGCCG -3'
(R):5'- GCCAAGGATACAGAACCCTAGA -3'

Sequencing Primer
(F):5'- TCCAATAGCTGACTGTGAGC -3'
(R):5'- GAACCCTAGACGTTCACTGCATG -3'
Posted On2018-07-23