Incidental Mutation 'R6676:Cldn9'
ID527296
Institutional Source Beutler Lab
Gene Symbol Cldn9
Ensembl Gene ENSMUSG00000066720
Gene Nameclaudin 9
Synonymsnmf329
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R6676 (G1)
Quality Score196.009
Status Not validated
Chromosome17
Chromosomal Location23682584-23684018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23683049 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 201 (S201P)
Ref Sequence ENSEMBL: ENSMUSP00000093236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024699] [ENSMUST00000085989]
Predicted Effect probably benign
Transcript: ENSMUST00000024699
SMART Domains Protein: ENSMUSP00000024699
Gene: ENSMUSG00000023906

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 181 2.5e-35 PFAM
Pfam:Claudin_2 15 183 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085989
AA Change: S201P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000093236
Gene: ENSMUSG00000066720
AA Change: S201P

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 181 9.7e-35 PFAM
Pfam:Claudin_2 15 183 8.1e-12 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: This intronless gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is developmentally regulated; it is expressed in neonate kidney, but disappers by adulthood. It is required for the preservation of sensory cells in the hearing organ and the gene deficiency is associated with deafness. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit severe and early hearing loss associated with degeneration of outer hair cells and increased perilymph potassium ion concentration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,469,915 L461P probably damaging Het
Adgra2 A T 8: 27,111,240 I303F possibly damaging Het
Clstn2 G T 9: 97,461,531 P621Q probably damaging Het
Ctdspl2 A G 2: 122,006,964 N403S probably damaging Het
Cyp2j5 T C 4: 96,635,808 Y329C possibly damaging Het
Elovl1 A G 4: 118,430,503 probably benign Het
Fam83a A G 15: 57,993,043 D206G possibly damaging Het
Fancd2 C T 6: 113,537,665 Q144* probably null Het
Fhl2 T C 1: 43,131,810 M115V possibly damaging Het
Fry T A 5: 150,380,922 D592E probably benign Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Mamdc2 T A 19: 23,303,633 I684F probably damaging Het
Mia2 T C 12: 59,108,370 Y290H probably damaging Het
Mup12 C T 4: 60,740,643 probably null Het
Olfr645 T C 7: 104,084,454 T209A probably benign Het
Olr1 T A 6: 129,500,077 probably null Het
Pcdhb15 T C 18: 37,474,807 V364A possibly damaging Het
Pfkp A G 13: 6,586,539 S654P possibly damaging Het
Rab3gap2 T G 1: 185,283,410 V1275G probably damaging Het
Rbbp4 A G 4: 129,328,621 F93L probably benign Het
Ripk1 T C 13: 34,010,604 V75A probably damaging Het
Scg2 T A 1: 79,435,782 Q368L possibly damaging Het
Tmprss9 A G 10: 80,898,311 probably benign Het
Other mutations in Cldn9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1687:Cldn9 UTSW 17 23683076 missense probably benign 0.00
R4195:Cldn9 UTSW 17 23683174 missense probably damaging 1.00
R5710:Cldn9 UTSW 17 23683447 missense probably damaging 1.00
R7007:Cldn9 UTSW 17 23683078 missense probably benign
R7336:Cldn9 UTSW 17 23683015 missense probably benign 0.27
Z1177:Cldn9 UTSW 17 23683201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGATCCCCTAAGAGCCAAGTC -3'
(R):5'- GGCATTTTGGTGCTCATCCC -3'

Sequencing Primer
(F):5'- AGTCCTGGCCAATAAGTGAGCTTC -3'
(R):5'- TGGACAGCCCATGCCATC -3'
Posted On2018-07-23