Mutagenetix > Incidental Mutation

Incidental Mutation 'R6677:Cfap65'

527300

Institutional Source

Beutler Lab

Gene Symbol

Cfap65

Ensembl Gene

ENSMUSG00000047021

Gene Name

cilia and flagella associated protein 65

Synonyms

Ccdc108, B230363K08Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.609) question?

Stock #

R6677 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74902071-74935599 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 74904685 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 1556 (D1556Y)

Ref Sequence

ENSEMBL: ENSMUSP00000092440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094844]

AlphaFold

Q3V0B4

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083682

Predicted Effect

probably damaging
Transcript: ENSMUST00000094844
AA Change: D1556Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: D1556Y

Domain	Start	End	E-Value	Type
transmembrane domain	111	133	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
internal_repeat_1	745	890	9.31e-5	PROSPERO
internal_repeat_1	1167	1322	9.31e-5	PROSPERO
low complexity region	1350	1361	N/A	INTRINSIC
low complexity region	1574	1592	N/A	INTRINSIC
coiled coil region	1687	1724	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160540

Meta Mutation Damage Score

0.1364

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.7%

Validation Efficiency

100% (31/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	G	T	8: 86,534,752	H713Q	possibly damaging	Het
Akap9	A	G	5: 4,029,869	T1874A	probably benign	Het
Atl1	A	G	12: 69,953,444	I289M	probably damaging	Het
Atp12a	A	G	14: 56,380,854	D654G	probably damaging	Het
Bbox1	C	A	2: 110,305,425	D70Y	probably damaging	Het
Blzf1	A	T	1: 164,302,612	V50D	possibly damaging	Het
C130060K24Rik	A	T	6: 65,456,245	I350F	probably benign	Het
Chrm2	A	T	6: 36,524,092	N295Y	probably damaging	Het
Clca3b	T	A	3: 144,823,384	E843V	probably benign	Het
Enpp3	T	A	10: 24,777,957	N701Y	possibly damaging	Het
Fbxo30	G	T	10: 11,290,636	L367F	possibly damaging	Het
Gm4841	A	T	18: 60,270,580	F147Y	probably damaging	Het
Gm8251	G	T	1: 44,058,699	R1080S	probably benign	Het
Lama1	G	A	17: 67,795,233	V1951I	probably benign	Het
Mgat4b	A	G	11: 50,233,071		probably null	Het
Mpp3	A	G	11: 102,008,618	V359A	probably benign	Het
Nhsl1	T	A	10: 18,525,862	D911E	probably damaging	Het
Olfr537-ps1	T	G	7: 140,538,552	F12V	probably damaging	Het
Polr1b	T	C	2: 129,120,211		probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Saxo2	T	C	7: 82,635,276	R125G	probably benign	Het
Scn8a	A	G	15: 100,969,072	D103G	probably damaging	Het
Sfxn2	A	T	19: 46,582,528	N9I	possibly damaging	Het
Shroom1	G	A	11: 53,463,516	A88T	possibly damaging	Het
Slc24a5	G	T	2: 125,080,695	A126S	possibly damaging	Het
Ssfa2	A	G	2: 79,655,101	T500A	possibly damaging	Het
Sult5a1	A	G	8: 123,149,278	F100L	probably benign	Het
Syne1	T	C	10: 5,040,942	Q579R	possibly damaging	Het
Vmn1r113	G	A	7: 20,787,978	G232S	probably benign	Het
Zic5	C	G	14: 122,465,154	R55P	unknown	Het

Other mutations in Cfap65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Cfap65	APN	1	74919183	critical splice donor site	probably null
IGL01526:Cfap65	APN	1	74911078	missense	probably damaging	1.00
IGL01716:Cfap65	APN	1	74927194	missense	probably benign
IGL01780:Cfap65	APN	1	74928348	nonsense	probably null
IGL01993:Cfap65	APN	1	74920543	missense	probably damaging	1.00
IGL02164:Cfap65	APN	1	74928145	missense	possibly damaging	0.87
IGL02350:Cfap65	APN	1	74928348	nonsense	probably null
IGL02357:Cfap65	APN	1	74928348	nonsense	probably null
IGL02576:Cfap65	APN	1	74903458	missense	probably damaging	1.00
IGL02756:Cfap65	APN	1	74905080	missense	probably benign	0.00
IGL02792:Cfap65	APN	1	74927178	missense	probably damaging	1.00
IGL02874:Cfap65	APN	1	74911108	nonsense	probably null
IGL03101:Cfap65	APN	1	74928433	missense	possibly damaging	0.61
IGL03348:Cfap65	APN	1	74927619	missense	probably damaging	1.00
IGL03396:Cfap65	APN	1	74904642	missense	probably damaging	1.00
PIT4131001:Cfap65	UTSW	1	74928342	missense	probably benign	0.05
R0077:Cfap65	UTSW	1	74931918	missense	probably damaging	1.00
R0227:Cfap65	UTSW	1	74931958	nonsense	probably null
R0281:Cfap65	UTSW	1	74927071	missense	probably damaging	1.00
R0312:Cfap65	UTSW	1	74904067	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74929301	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74929302	missense	probably damaging	1.00
R0347:Cfap65	UTSW	1	74926444	missense	probably damaging	1.00
R0359:Cfap65	UTSW	1	74920601	missense	probably benign	0.00
R0361:Cfap65	UTSW	1	74925440	missense	probably damaging	1.00
R0465:Cfap65	UTSW	1	74916884	missense	possibly damaging	0.92
R0549:Cfap65	UTSW	1	74918444	missense	probably benign	0.01
R0646:Cfap65	UTSW	1	74902169	missense	probably benign	0.09
R0734:Cfap65	UTSW	1	74918887	missense	probably damaging	1.00
R0763:Cfap65	UTSW	1	74904682	missense	probably damaging	0.99
R0990:Cfap65	UTSW	1	74921519	missense	possibly damaging	0.60
R1079:Cfap65	UTSW	1	74902447	missense	probably damaging	0.98
R1079:Cfap65	UTSW	1	74905713	missense	probably damaging	0.99
R1083:Cfap65	UTSW	1	74918504	splice site	probably benign
R1159:Cfap65	UTSW	1	74929340	missense	probably damaging	1.00
R1282:Cfap65	UTSW	1	74925104	missense	probably benign	0.03
R1644:Cfap65	UTSW	1	74917175	missense	probably damaging	1.00
R1796:Cfap65	UTSW	1	74918948	missense	probably damaging	1.00
R1950:Cfap65	UTSW	1	74907660	missense	probably damaging	1.00
R2079:Cfap65	UTSW	1	74917199	missense	probably benign	0.30
R2132:Cfap65	UTSW	1	74907691	missense	probably damaging	1.00
R2136:Cfap65	UTSW	1	74917273	frame shift	probably null
R2219:Cfap65	UTSW	1	74904025	missense	probably damaging	1.00
R2220:Cfap65	UTSW	1	74904025	missense	probably damaging	1.00
R2291:Cfap65	UTSW	1	74926475	missense	probably damaging	1.00
R2417:Cfap65	UTSW	1	74927186	small insertion	probably benign
R3114:Cfap65	UTSW	1	74927132	missense	probably damaging	1.00
R4202:Cfap65	UTSW	1	74920542	missense	probably damaging	1.00
R4214:Cfap65	UTSW	1	74927681	missense	possibly damaging	0.93
R4254:Cfap65	UTSW	1	74903358	missense	probably benign	0.17
R4547:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4548:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4588:Cfap65	UTSW	1	74904056	missense	possibly damaging	0.92
R4657:Cfap65	UTSW	1	74925354	intron	probably benign
R4701:Cfap65	UTSW	1	74918908	missense	probably damaging	0.96
R4755:Cfap65	UTSW	1	74928361	missense	probably damaging	1.00
R4820:Cfap65	UTSW	1	74927632	missense	probably benign	0.06
R4831:Cfap65	UTSW	1	74917295	missense	possibly damaging	0.93
R4866:Cfap65	UTSW	1	74925557	missense	probably damaging	1.00
R4869:Cfap65	UTSW	1	74919261	missense	probably benign	0.00
R4881:Cfap65	UTSW	1	74907613	missense	probably damaging	1.00
R4884:Cfap65	UTSW	1	74903124	missense	possibly damaging	0.47
R4950:Cfap65	UTSW	1	74906336	nonsense	probably null
R5074:Cfap65	UTSW	1	74922978	missense	probably benign	0.04
R5083:Cfap65	UTSW	1	74906441	missense	probably damaging	1.00
R5164:Cfap65	UTSW	1	74926516	missense	probably damaging	1.00
R5268:Cfap65	UTSW	1	74924902	missense	probably benign	0.07
R5333:Cfap65	UTSW	1	74903175	missense	probably benign	0.03
R5417:Cfap65	UTSW	1	74925100	missense	probably damaging	1.00
R5582:Cfap65	UTSW	1	74907518	intron	probably benign
R5669:Cfap65	UTSW	1	74924968	missense	probably damaging	0.99
R6010:Cfap65	UTSW	1	74923031	missense	probably damaging	1.00
R6084:Cfap65	UTSW	1	74920405	missense	probably damaging	1.00
R6112:Cfap65	UTSW	1	74903139	missense	probably benign	0.14
R6425:Cfap65	UTSW	1	74927709	missense	probably benign	0.00
R6693:Cfap65	UTSW	1	74917286	missense	probably benign	0.00
R6838:Cfap65	UTSW	1	74932021	missense	probably benign	0.06
R6861:Cfap65	UTSW	1	74925115	missense	probably damaging	1.00
R6958:Cfap65	UTSW	1	74931899	missense	possibly damaging	0.58
R7134:Cfap65	UTSW	1	74926633	missense	probably benign	0.01
R7320:Cfap65	UTSW	1	74926604	missense	probably damaging	0.99
R7340:Cfap65	UTSW	1	74921583	missense	probably benign	0.07
R7426:Cfap65	UTSW	1	74920426	missense	possibly damaging	0.92
R7529:Cfap65	UTSW	1	74926610	missense	probably damaging	1.00
R7634:Cfap65	UTSW	1	74902434	missense	probably damaging	1.00
R7654:Cfap65	UTSW	1	74933144	missense	probably benign	0.44
R7704:Cfap65	UTSW	1	74928368	missense	probably benign	0.19
R7727:Cfap65	UTSW	1	74926625	missense	probably benign	0.00
R7895:Cfap65	UTSW	1	74933162	missense	probably benign	0.05
R8215:Cfap65	UTSW	1	74910743	missense	probably damaging	1.00
R8344:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8345:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8413:Cfap65	UTSW	1	74917169	nonsense	probably null
R8431:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8432:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8528:Cfap65	UTSW	1	74905937	missense	possibly damaging	0.88
R8809:Cfap65	UTSW	1	74903223	missense	probably benign	0.43
R8996:Cfap65	UTSW	1	74902188	missense	probably benign	0.11
R9020:Cfap65	UTSW	1	74920393	missense	probably damaging	1.00
R9043:Cfap65	UTSW	1	74904688	missense	possibly damaging	0.88
R9127:Cfap65	UTSW	1	74919351	splice site	probably benign
R9187:Cfap65	UTSW	1	74917358	missense	probably benign	0.00
R9210:Cfap65	UTSW	1	74920408	missense	probably benign
R9212:Cfap65	UTSW	1	74920408	missense	probably benign
R9273:Cfap65	UTSW	1	74921610	missense	probably benign	0.00
R9454:Cfap65	UTSW	1	74905051	missense	probably damaging	1.00
R9514:Cfap65	UTSW	1	74906309	critical splice donor site	probably null
R9595:Cfap65	UTSW	1	74907378	missense	probably damaging	1.00
R9721:Cfap65	UTSW	1	74919342	missense	probably benign	0.16
R9742:Cfap65	UTSW	1	74904681	missense	probably benign	0.08
RF009:Cfap65	UTSW	1	74905647	missense	probably damaging	1.00
Z1176:Cfap65	UTSW	1	74910747	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCTAAAGGCTGAGTGTGGAC -3'
(R):5'- ATGGGATTATAGCTGCCCTACC -3'

Sequencing Primer
(F):5'- AGTGTGGACATCTGCTGCTCTAC -3'
(R):5'- GATTATAGCTGCCCTACCACCCATG -3'

Posted On

2018-07-23