Incidental Mutation 'R6677:Clca3b'
ID 527306
Institutional Source Beutler Lab
Gene Symbol Clca3b
Ensembl Gene ENSMUSG00000037033
Gene Name chloride channel accessory 3B
Synonyms Clca4
MMRRC Submission 044796-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R6677 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 144528384-144555063 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 144529145 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 843 (E843V)
Ref Sequence ENSEMBL: ENSMUSP00000124581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029929] [ENSMUST00000159989]
AlphaFold E9PUL3
Predicted Effect probably benign
Transcript: ENSMUST00000029929
SMART Domains Protein: ENSMUSP00000029929
Gene: ENSMUSG00000028262

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.5e-21 SMART
FN3 758 857 5.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159989
AA Change: E843V

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124581
Gene: ENSMUSG00000037033
AA Change: E843V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 481 6.22e-19 SMART
FN3 762 861 4.93e0 SMART
low complexity region 880 1025 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 G T 8: 87,261,381 (GRCm39) H713Q possibly damaging Het
Akap9 A G 5: 4,079,869 (GRCm39) T1874A probably benign Het
Atl1 A G 12: 70,000,218 (GRCm39) I289M probably damaging Het
Atp12a A G 14: 56,618,311 (GRCm39) D654G probably damaging Het
Bbox1 C A 2: 110,135,770 (GRCm39) D70Y probably damaging Het
Blzf1 A T 1: 164,130,181 (GRCm39) V50D possibly damaging Het
Ccdc168 G T 1: 44,097,859 (GRCm39) R1080S probably benign Het
Cfap65 C A 1: 74,943,844 (GRCm39) D1556Y probably damaging Het
Chrm2 A T 6: 36,501,027 (GRCm39) N295Y probably damaging Het
Enpp3 T A 10: 24,653,855 (GRCm39) N701Y possibly damaging Het
Fbxo30 G T 10: 11,166,380 (GRCm39) L367F possibly damaging Het
Gm4841 A T 18: 60,403,652 (GRCm39) F147Y probably damaging Het
Itprid2 A G 2: 79,485,445 (GRCm39) T500A possibly damaging Het
Lama1 G A 17: 68,102,228 (GRCm39) V1951I probably benign Het
Mgat4b A G 11: 50,123,898 (GRCm39) probably null Het
Mpp3 A G 11: 101,899,444 (GRCm39) V359A probably benign Het
Nhsl1 T A 10: 18,401,610 (GRCm39) D911E probably damaging Het
Or13a23-ps1 T G 7: 140,118,465 (GRCm39) F12V probably damaging Het
Polr1b T C 2: 128,962,131 (GRCm39) probably benign Het
Qrfprl A T 6: 65,433,229 (GRCm39) I350F probably benign Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Saxo2 T C 7: 82,284,484 (GRCm39) R125G probably benign Het
Scn8a A G 15: 100,866,953 (GRCm39) D103G probably damaging Het
Sfxn2 A T 19: 46,570,967 (GRCm39) N9I possibly damaging Het
Shroom1 G A 11: 53,354,343 (GRCm39) A88T possibly damaging Het
Slc24a5 G T 2: 124,922,615 (GRCm39) A126S possibly damaging Het
Sult5a1 A G 8: 123,876,017 (GRCm39) F100L probably benign Het
Syne1 T C 10: 4,990,942 (GRCm39) Q579R possibly damaging Het
Vmn1r113 G A 7: 20,521,903 (GRCm39) G232S probably benign Het
Zic5 C G 14: 122,702,566 (GRCm39) R55P unknown Het
Other mutations in Clca3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Clca3b APN 3 144,542,393 (GRCm39) missense probably damaging 0.96
IGL00425:Clca3b APN 3 144,542,342 (GRCm39) missense probably benign 0.14
IGL00725:Clca3b APN 3 144,544,923 (GRCm39) missense probably benign 0.01
IGL00898:Clca3b APN 3 144,550,389 (GRCm39) splice site probably benign
IGL00953:Clca3b APN 3 144,552,972 (GRCm39) nonsense probably null
IGL01089:Clca3b APN 3 144,529,283 (GRCm39) missense probably benign
IGL01376:Clca3b APN 3 144,531,812 (GRCm39) missense possibly damaging 0.60
IGL01996:Clca3b APN 3 144,554,924 (GRCm39) missense probably benign 0.04
IGL02022:Clca3b APN 3 144,547,171 (GRCm39) critical splice donor site probably null
IGL02200:Clca3b APN 3 144,547,190 (GRCm39) missense probably damaging 1.00
IGL02314:Clca3b APN 3 144,533,903 (GRCm39) splice site probably benign
IGL02331:Clca3b APN 3 144,547,167 (GRCm39) splice site probably benign
IGL02429:Clca3b APN 3 144,533,896 (GRCm39) missense probably damaging 1.00
IGL02868:Clca3b APN 3 144,533,325 (GRCm39) missense probably damaging 1.00
IGL03095:Clca3b APN 3 144,552,671 (GRCm39) nonsense probably null
IGL03331:Clca3b APN 3 144,533,724 (GRCm39) missense probably benign
R0242:Clca3b UTSW 3 144,547,226 (GRCm39) missense probably benign 0.00
R0242:Clca3b UTSW 3 144,547,226 (GRCm39) missense probably benign 0.00
R0506:Clca3b UTSW 3 144,528,627 (GRCm39) unclassified probably benign
R0524:Clca3b UTSW 3 144,531,082 (GRCm39) missense probably benign
R0637:Clca3b UTSW 3 144,533,701 (GRCm39) missense probably benign 0.03
R1577:Clca3b UTSW 3 144,529,280 (GRCm39) missense probably damaging 1.00
R1641:Clca3b UTSW 3 144,529,274 (GRCm39) missense possibly damaging 0.53
R1680:Clca3b UTSW 3 144,543,585 (GRCm39) missense probably damaging 1.00
R2240:Clca3b UTSW 3 144,531,696 (GRCm39) missense probably benign 0.22
R2248:Clca3b UTSW 3 144,530,980 (GRCm39) missense probably benign 0.01
R2259:Clca3b UTSW 3 144,552,142 (GRCm39) missense possibly damaging 0.80
R2920:Clca3b UTSW 3 144,552,692 (GRCm39) missense probably benign 0.01
R2920:Clca3b UTSW 3 144,543,614 (GRCm39) missense probably benign 0.31
R4355:Clca3b UTSW 3 144,531,219 (GRCm39) splice site probably null
R4691:Clca3b UTSW 3 144,544,853 (GRCm39) missense probably benign 0.02
R4828:Clca3b UTSW 3 144,550,273 (GRCm39) missense probably benign 0.02
R4845:Clca3b UTSW 3 144,531,031 (GRCm39) missense probably benign
R5182:Clca3b UTSW 3 144,533,776 (GRCm39) missense probably damaging 0.99
R5396:Clca3b UTSW 3 144,552,932 (GRCm39) missense probably damaging 0.99
R5429:Clca3b UTSW 3 144,552,220 (GRCm39) missense probably damaging 1.00
R5572:Clca3b UTSW 3 144,533,070 (GRCm39) missense probably damaging 1.00
R5657:Clca3b UTSW 3 144,533,144 (GRCm39) missense probably benign 0.25
R5845:Clca3b UTSW 3 144,531,077 (GRCm39) missense possibly damaging 0.46
R6505:Clca3b UTSW 3 144,531,020 (GRCm39) missense probably benign 0.18
R6707:Clca3b UTSW 3 144,550,288 (GRCm39) missense probably benign 0.00
R7001:Clca3b UTSW 3 144,533,733 (GRCm39) missense possibly damaging 0.48
R7285:Clca3b UTSW 3 144,543,519 (GRCm39) missense probably benign 0.00
R7323:Clca3b UTSW 3 144,531,681 (GRCm39) missense possibly damaging 0.60
R7324:Clca3b UTSW 3 144,547,181 (GRCm39) missense possibly damaging 0.81
R7334:Clca3b UTSW 3 144,542,417 (GRCm39) nonsense probably null
R7403:Clca3b UTSW 3 144,529,259 (GRCm39) missense probably benign 0.00
R7798:Clca3b UTSW 3 144,533,891 (GRCm39) missense probably damaging 1.00
R8008:Clca3b UTSW 3 144,550,370 (GRCm39) missense probably benign 0.44
R8132:Clca3b UTSW 3 144,552,935 (GRCm39) missense probably benign 0.13
R8181:Clca3b UTSW 3 144,544,898 (GRCm39) missense probably benign 0.00
R8305:Clca3b UTSW 3 144,531,698 (GRCm39) missense probably damaging 1.00
R8546:Clca3b UTSW 3 144,533,158 (GRCm39) missense probably damaging 0.99
R8716:Clca3b UTSW 3 144,550,355 (GRCm39) missense probably benign 0.14
R8804:Clca3b UTSW 3 144,544,898 (GRCm39) missense probably benign 0.00
R8966:Clca3b UTSW 3 144,544,872 (GRCm39) missense probably benign 0.27
R9003:Clca3b UTSW 3 144,533,072 (GRCm39) nonsense probably null
R9455:Clca3b UTSW 3 144,529,023 (GRCm39) missense unknown
R9470:Clca3b UTSW 3 144,543,456 (GRCm39) missense probably damaging 1.00
R9658:Clca3b UTSW 3 144,543,575 (GRCm39) missense probably damaging 0.98
R9760:Clca3b UTSW 3 144,552,610 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACTTTGGTACCCAGACCAG -3'
(R):5'- CGCTAACGAACGTGATGTTTC -3'

Sequencing Primer
(F):5'- TGCTGGGGGTACTCAGAC -3'
(R):5'- ACGAACGTGATGTTTCTCTTTTCTAG -3'
Posted On 2018-07-23