Incidental Mutation 'R6677:Atl1'
ID527324
Institutional Source Beutler Lab
Gene Symbol Atl1
Ensembl Gene ENSMUSG00000021066
Gene Nameatlastin GTPase 1
SynonymsAD-FSP, Spg3a, FSP1, SPG3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R6677 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location69892614-69966417 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69953444 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 289 (I289M)
Ref Sequence ENSEMBL: ENSMUSP00000021466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021466]
Predicted Effect probably damaging
Transcript: ENSMUST00000021466
AA Change: I289M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021466
Gene: ENSMUSG00000021066
AA Change: I289M

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:GBP 43 314 2.3e-103 PFAM
low complexity region 350 363 N/A INTRINSIC
Blast:HAMP 468 519 9e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222246
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: This gene encodes a member of the dynamin family of GTPases. The encoded protein interacts with tubule-shaping proteins of the endoplasmic reticulum. Mutations in the homologous human gene can cause hereditary spastic paraplegia. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous animals show a gait disturbance characterized by external rotation of the hind feet with footprint analysis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 G T 8: 86,534,752 H713Q possibly damaging Het
Akap9 A G 5: 4,029,869 T1874A probably benign Het
Atp12a A G 14: 56,380,854 D654G probably damaging Het
Bbox1 C A 2: 110,305,425 D70Y probably damaging Het
Blzf1 A T 1: 164,302,612 V50D possibly damaging Het
C130060K24Rik A T 6: 65,456,245 I350F probably benign Het
Cfap65 C A 1: 74,904,685 D1556Y probably damaging Het
Chrm2 A T 6: 36,524,092 N295Y probably damaging Het
Clca3b T A 3: 144,823,384 E843V probably benign Het
Enpp3 T A 10: 24,777,957 N701Y possibly damaging Het
Fbxo30 G T 10: 11,290,636 L367F possibly damaging Het
Gm4841 A T 18: 60,270,580 F147Y probably damaging Het
Gm8251 G T 1: 44,058,699 R1080S probably benign Het
Lama1 G A 17: 67,795,233 V1951I probably benign Het
Mgat4b A G 11: 50,233,071 probably null Het
Mpp3 A G 11: 102,008,618 V359A probably benign Het
Nhsl1 T A 10: 18,525,862 D911E probably damaging Het
Olfr537-ps1 T G 7: 140,538,552 F12V probably damaging Het
Polr1b T C 2: 129,120,211 probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Saxo2 T C 7: 82,635,276 R125G probably benign Het
Scn8a A G 15: 100,969,072 D103G probably damaging Het
Sfxn2 A T 19: 46,582,528 N9I possibly damaging Het
Shroom1 G A 11: 53,463,516 A88T possibly damaging Het
Slc24a5 G T 2: 125,080,695 A126S possibly damaging Het
Ssfa2 A G 2: 79,655,101 T500A possibly damaging Het
Sult5a1 A G 8: 123,149,278 F100L probably benign Het
Syne1 T C 10: 5,040,942 Q579R possibly damaging Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Zic5 C G 14: 122,465,154 R55P unknown Het
Other mutations in Atl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Atl1 APN 12 69932238 missense probably damaging 0.99
IGL02035:Atl1 APN 12 69960544 unclassified probably benign
IGL02229:Atl1 APN 12 69926025 missense probably benign 0.01
IGL03282:Atl1 APN 12 69954464 missense possibly damaging 0.87
IGL03374:Atl1 APN 12 69955367 missense probably damaging 1.00
R1538:Atl1 UTSW 12 69926188 missense probably benign 0.02
R1819:Atl1 UTSW 12 69963300 missense probably benign
R1903:Atl1 UTSW 12 69959275 missense probably damaging 0.98
R1961:Atl1 UTSW 12 69953500 missense probably benign 0.00
R1990:Atl1 UTSW 12 69963328 missense probably damaging 1.00
R2126:Atl1 UTSW 12 69931657 splice site probably null
R3724:Atl1 UTSW 12 69959380 missense probably damaging 0.99
R4402:Atl1 UTSW 12 69959199 missense probably benign 0.09
R5241:Atl1 UTSW 12 69959113 missense possibly damaging 0.52
R5256:Atl1 UTSW 12 69959333 missense probably damaging 1.00
R5285:Atl1 UTSW 12 69954499 missense probably benign 0.18
R5866:Atl1 UTSW 12 69926011 missense probably damaging 0.98
R6001:Atl1 UTSW 12 69932283 missense possibly damaging 0.92
R6434:Atl1 UTSW 12 69959425 nonsense probably null
R6728:Atl1 UTSW 12 69947550 missense possibly damaging 0.95
R6974:Atl1 UTSW 12 69926039 missense probably damaging 0.99
R7013:Atl1 UTSW 12 69953440 missense probably damaging 1.00
R7121:Atl1 UTSW 12 69931634 missense probably damaging 0.99
R7224:Atl1 UTSW 12 69955353 missense probably benign
R7437:Atl1 UTSW 12 69931622 missense probably benign 0.37
R8043:Atl1 UTSW 12 69959215 missense probably damaging 1.00
R8319:Atl1 UTSW 12 69955319 missense probably damaging 0.99
Z1176:Atl1 UTSW 12 69937075 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AGCCATGAATTACCTGCCC -3'
(R):5'- ATGTGAGGGGAAGTGCTCAC -3'

Sequencing Primer
(F):5'- GAGTTAGTTCAAAGCCAGCCTTG -3'
(R):5'- TGAGGGGAAGTGCTCACAAGAG -3'
Posted On2018-07-23