Incidental Mutation 'R6678:Adgrb3'
ID527330
Institutional Source Beutler Lab
Gene Symbol Adgrb3
Ensembl Gene ENSMUSG00000033569
Gene Nameadhesion G protein-coupled receptor B3
SynonymsBai3, A830096D10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.427) question?
Stock #R6678 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location25067476-25829707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25460810 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 644 (N644S)
Ref Sequence ENSEMBL: ENSMUSP00000116231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041838] [ENSMUST00000135518] [ENSMUST00000146592] [ENSMUST00000151309]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041838
AA Change: N644S

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035612
Gene: ENSMUSG00000033569
AA Change: N644S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000135518
AA Change: N644S

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119804
Gene: ENSMUSG00000033569
AA Change: N644S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000146592
AA Change: N437S

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116759
Gene: ENSMUSG00000033569
AA Change: N437S

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
TSP1 87 136 2.1e-12 SMART
TSP1 141 191 7.97e-13 SMART
TSP1 196 246 6.28e-11 SMART
TSP1 251 301 1.48e-7 SMART
HormR 303 369 4.15e-20 SMART
Pfam:DUF3497 379 603 2.5e-52 PFAM
GPS 608 661 1.24e-21 SMART
Pfam:7tm_2 667 903 5.4e-66 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000151309
AA Change: N644S

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116231
Gene: ENSMUSG00000033569
AA Change: N644S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:GAIN 589 794 1.1e-44 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 875 1143 2.7e-63 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor, a seven-span transmembrane protein, and is thought to be a member of the secretin receptor family. Brain-specific angiogenesis proteins BAI2 and BAI3 are similar to BAI1 in structure, have similar tissue specificities, and may also play a role in angiogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in Purkinje cells exhibit impaired motor learning with alterned climbing fiber electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl C A 3: 116,753,320 V1294F probably damaging Het
Ash2l A C 8: 25,833,777 W125G probably damaging Het
Dap C T 15: 31,273,250 T51M probably benign Het
Dnah12 G A 14: 26,735,692 R871H probably damaging Het
Filip1l T C 16: 57,569,970 I307T probably benign Het
Gdap1l1 T A 2: 163,438,654 S37T probably benign Het
Gm43302 G T 5: 105,290,954 Q23K probably benign Het
Gm8765 A G 13: 50,701,910 K528R probably benign Het
Golga2 T C 2: 32,299,060 V227A probably damaging Het
Gramd4 A T 15: 86,091,503 S74C probably damaging Het
Gramd4 G C 15: 86,091,504 S74T possibly damaging Het
Hsph1 A C 5: 149,618,497 S755A probably benign Het
Inppl1 A G 7: 101,832,270 V235A probably damaging Het
Kcnc1 A G 7: 46,397,805 H43R probably benign Het
Klhl41 T G 2: 69,670,844 S216R probably benign Het
Kmt2e A G 5: 23,499,295 E1162G possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Ms4a13 T C 19: 11,183,858 I106V probably benign Het
Myo1f G A 17: 33,575,845 D20N probably damaging Het
Ndel1 T C 11: 68,833,413 T245A possibly damaging Het
Olfr1042 A T 2: 86,160,185 F62I probably damaging Het
P2rx6 C A 16: 17,570,956 N360K probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Plcl1 A G 1: 55,695,776 K92R probably benign Het
Prelp C T 1: 133,914,775 D211N probably benign Het
Rgl1 T C 1: 152,524,724 Y677C probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rreb1 G T 13: 37,899,699 D113Y probably damaging Het
Sf1 T A 19: 6,374,513 probably null Het
Sh3bp1 T C 15: 78,908,514 probably null Het
Shprh T A 10: 11,166,545 D757E probably benign Het
Slc6a1 A G 6: 114,307,776 K81R probably benign Het
Ttc22 T A 4: 106,623,045 S165R probably benign Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vwa7 C A 17: 35,019,800 A288D probably damaging Het
Wdpcp A G 11: 21,721,105 I449V probably benign Het
Wdsub1 G A 2: 59,862,631 T313I probably benign Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in Adgrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Adgrb3 APN 1 25228500 missense probably benign 0.09
IGL00507:Adgrb3 APN 1 25074715 missense possibly damaging 0.93
IGL00828:Adgrb3 APN 1 25488119 missense possibly damaging 0.73
IGL01285:Adgrb3 APN 1 25093787 missense probably benign 0.32
IGL01309:Adgrb3 APN 1 25112271 missense possibly damaging 0.69
IGL01540:Adgrb3 APN 1 25112171 splice site probably null
IGL01608:Adgrb3 APN 1 25553774 missense probably damaging 1.00
IGL01638:Adgrb3 APN 1 25559751 splice site probably benign
IGL01657:Adgrb3 APN 1 25826493 missense probably benign 0.03
IGL01666:Adgrb3 APN 1 25460751 missense probably damaging 0.96
IGL01712:Adgrb3 APN 1 25826279 missense probably benign
IGL01767:Adgrb3 APN 1 25559814 missense probably benign 0.00
IGL01987:Adgrb3 APN 1 25101431 critical splice donor site probably null
IGL02201:Adgrb3 APN 1 25420550 splice site probably benign
IGL02584:Adgrb3 APN 1 25504984 missense probably damaging 0.98
IGL02685:Adgrb3 APN 1 25084242 critical splice donor site probably null
IGL02886:Adgrb3 APN 1 25504910 splice site probably null
IGL02929:Adgrb3 APN 1 25553824 missense probably benign 0.00
IGL03153:Adgrb3 APN 1 25531897 nonsense probably null
IGL03165:Adgrb3 APN 1 25094394 missense probably benign 0.05
IGL03227:Adgrb3 APN 1 25547475 missense probably damaging 1.00
IGL03392:Adgrb3 APN 1 25504448 missense probably damaging 0.99
schwach UTSW 1 25111691 critical splice donor site probably null
R0007:Adgrb3 UTSW 1 25111691 critical splice donor site probably null
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0322:Adgrb3 UTSW 1 25221748 splice site probably benign
R0442:Adgrb3 UTSW 1 25396470 missense probably damaging 0.96
R0563:Adgrb3 UTSW 1 25547554 missense probably damaging 0.99
R1168:Adgrb3 UTSW 1 25826199 missense probably benign
R1252:Adgrb3 UTSW 1 25128828 missense probably damaging 1.00
R1264:Adgrb3 UTSW 1 25559850 missense probably damaging 0.97
R1543:Adgrb3 UTSW 1 25488088 missense probably benign 0.01
R1577:Adgrb3 UTSW 1 25094183 missense possibly damaging 0.51
R1581:Adgrb3 UTSW 1 25094072 missense possibly damaging 0.94
R1583:Adgrb3 UTSW 1 25226831 splice site probably null
R1653:Adgrb3 UTSW 1 25101503 missense probably benign 0.09
R1725:Adgrb3 UTSW 1 25826300 missense probably damaging 1.00
R1792:Adgrb3 UTSW 1 25228471 missense probably damaging 1.00
R1827:Adgrb3 UTSW 1 25532577 missense probably damaging 0.99
R1838:Adgrb3 UTSW 1 25084270 missense probably damaging 1.00
R1869:Adgrb3 UTSW 1 25826438 missense possibly damaging 0.83
R1971:Adgrb3 UTSW 1 25547444 missense probably benign 0.02
R2005:Adgrb3 UTSW 1 25111718 missense probably benign 0.25
R2134:Adgrb3 UTSW 1 25093957 missense probably damaging 0.99
R2142:Adgrb3 UTSW 1 25068209 missense probably damaging 1.00
R2268:Adgrb3 UTSW 1 25111817 missense possibly damaging 0.79
R3740:Adgrb3 UTSW 1 25826454 missense probably benign 0.00
R3877:Adgrb3 UTSW 1 25111825 missense probably damaging 1.00
R4120:Adgrb3 UTSW 1 25094307 nonsense probably null
R4344:Adgrb3 UTSW 1 25826748 missense possibly damaging 0.61
R4363:Adgrb3 UTSW 1 25112222 missense probably damaging 1.00
R4438:Adgrb3 UTSW 1 25831027 unclassified probably benign
R4465:Adgrb3 UTSW 1 25094366 missense probably damaging 1.00
R4480:Adgrb3 UTSW 1 25111748 missense probably damaging 1.00
R4554:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4557:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4622:Adgrb3 UTSW 1 25826488 missense probably damaging 0.99
R4713:Adgrb3 UTSW 1 25547532 missense probably damaging 1.00
R4772:Adgrb3 UTSW 1 25531875 missense probably damaging 1.00
R4890:Adgrb3 UTSW 1 25221827 missense probably damaging 1.00
R5045:Adgrb3 UTSW 1 25074779 missense probably damaging 1.00
R5061:Adgrb3 UTSW 1 25068128 utr 3 prime probably benign
R5097:Adgrb3 UTSW 1 25826084 missense probably damaging 1.00
R5227:Adgrb3 UTSW 1 25093952 missense possibly damaging 0.55
R5241:Adgrb3 UTSW 1 25111790 missense possibly damaging 0.85
R5328:Adgrb3 UTSW 1 25094275 missense possibly damaging 0.90
R5372:Adgrb3 UTSW 1 25128859 missense probably benign 0.01
R5703:Adgrb3 UTSW 1 25420559 missense probably damaging 1.00
R5747:Adgrb3 UTSW 1 25826562 missense probably damaging 1.00
R5998:Adgrb3 UTSW 1 25431501 splice site probably null
R6006:Adgrb3 UTSW 1 25826531 missense possibly damaging 0.85
R6077:Adgrb3 UTSW 1 25094000 nonsense probably null
R6183:Adgrb3 UTSW 1 25094370 missense probably damaging 0.98
R6190:Adgrb3 UTSW 1 25420647 missense probably benign 0.01
R6249:Adgrb3 UTSW 1 25432558 missense probably damaging 1.00
R6310:Adgrb3 UTSW 1 25111718 missense probably benign 0.13
R6450:Adgrb3 UTSW 1 25420602 missense probably benign
R6679:Adgrb3 UTSW 1 25131296 missense probably benign 0.01
R6685:Adgrb3 UTSW 1 25111736 nonsense probably null
R6730:Adgrb3 UTSW 1 25094294 missense probably damaging 1.00
R6805:Adgrb3 UTSW 1 25826172 missense possibly damaging 0.83
R6847:Adgrb3 UTSW 1 25093922 missense probably benign 0.03
R6929:Adgrb3 UTSW 1 25111771 nonsense probably null
R6953:Adgrb3 UTSW 1 25826511 missense probably damaging 1.00
R7062:Adgrb3 UTSW 1 25826085 missense possibly damaging 0.90
R7244:Adgrb3 UTSW 1 25131269 missense probably damaging 1.00
R7292:Adgrb3 UTSW 1 25531876 missense probably damaging 1.00
R7325:Adgrb3 UTSW 1 25532630 missense probably benign 0.01
R7378:Adgrb3 UTSW 1 25531919 nonsense probably null
R7489:Adgrb3 UTSW 1 25547505 missense probably damaging 1.00
Z1088:Adgrb3 UTSW 1 25131271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTTGATTTCTGTAAAGTTGACTGT -3'
(R):5'- GAGGAATTATGATGCTGAGGAGACTT -3'

Sequencing Primer
(F):5'- TCCAAGATCATGTCATACTC -3'
(R):5'- ATGAGAGTGCCTTCCCACTGAC -3'
Posted On2018-07-23