Incidental Mutation 'R6678:Hsph1'
ID527344
Institutional Source Beutler Lab
Gene Symbol Hsph1
Ensembl Gene ENSMUSG00000029657
Gene Nameheat shock 105kDa/110kDa protein 1
SynonymsHsp105, hsp-E7I, HSP110
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.574) question?
Stock #R6678 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location149614287-149636376 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 149618497 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 755 (S755A)
Ref Sequence ENSEMBL: ENSMUSP00000144413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074846] [ENSMUST00000201452] [ENSMUST00000202089] [ENSMUST00000202361]
Predicted Effect probably benign
Transcript: ENSMUST00000074846
AA Change: S711A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074392
Gene: ENSMUSG00000029657
AA Change: S711A

DomainStartEndE-ValueType
Pfam:HSP70 3 709 7.3e-190 PFAM
low complexity region 756 768 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201431
Predicted Effect probably benign
Transcript: ENSMUST00000201452
AA Change: S755A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144654
Gene: ENSMUSG00000029657
AA Change: S755A

DomainStartEndE-ValueType
Pfam:HSP70 3 709 7.3e-190 PFAM
low complexity region 756 768 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201877
Predicted Effect probably benign
Transcript: ENSMUST00000202089
AA Change: S714A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144297
Gene: ENSMUSG00000029657
AA Change: S714A

DomainStartEndE-ValueType
Pfam:HSP70 3 103 1.3e-33 PFAM
Pfam:HSP70 98 668 8.5e-135 PFAM
low complexity region 715 727 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202137
Predicted Effect probably benign
Transcript: ENSMUST00000202361
AA Change: S755A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144413
Gene: ENSMUSG00000029657
AA Change: S755A

DomainStartEndE-ValueType
Pfam:HSP70 3 709 7.3e-190 PFAM
low complexity region 756 768 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 97% (37/38)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene leads to decreased susceptibility to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,460,810 N644S possibly damaging Het
Agl C A 3: 116,753,320 V1294F probably damaging Het
Ash2l A C 8: 25,833,777 W125G probably damaging Het
Dap C T 15: 31,273,250 T51M probably benign Het
Dnah12 G A 14: 26,735,692 R871H probably damaging Het
Filip1l T C 16: 57,569,970 I307T probably benign Het
Gdap1l1 T A 2: 163,438,654 S37T probably benign Het
Gm43302 G T 5: 105,290,954 Q23K probably benign Het
Gm8765 A G 13: 50,701,910 K528R probably benign Het
Golga2 T C 2: 32,299,060 V227A probably damaging Het
Gramd4 A T 15: 86,091,503 S74C probably damaging Het
Gramd4 G C 15: 86,091,504 S74T possibly damaging Het
Inppl1 A G 7: 101,832,270 V235A probably damaging Het
Kcnc1 A G 7: 46,397,805 H43R probably benign Het
Klhl41 T G 2: 69,670,844 S216R probably benign Het
Kmt2e A G 5: 23,499,295 E1162G possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Ms4a13 T C 19: 11,183,858 I106V probably benign Het
Myo1f G A 17: 33,575,845 D20N probably damaging Het
Ndel1 T C 11: 68,833,413 T245A possibly damaging Het
Olfr1042 A T 2: 86,160,185 F62I probably damaging Het
P2rx6 C A 16: 17,570,956 N360K probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Plcl1 A G 1: 55,695,776 K92R probably benign Het
Prelp C T 1: 133,914,775 D211N probably benign Het
Rgl1 T C 1: 152,524,724 Y677C probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rreb1 G T 13: 37,899,699 D113Y probably damaging Het
Sf1 T A 19: 6,374,513 probably null Het
Sh3bp1 T C 15: 78,908,514 probably null Het
Shprh T A 10: 11,166,545 D757E probably benign Het
Slc6a1 A G 6: 114,307,776 K81R probably benign Het
Ttc22 T A 4: 106,623,045 S165R probably benign Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vwa7 C A 17: 35,019,800 A288D probably damaging Het
Wdpcp A G 11: 21,721,105 I449V probably benign Het
Wdsub1 G A 2: 59,862,631 T313I probably benign Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in Hsph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Hsph1 APN 5 149618789 missense possibly damaging 0.95
IGL00839:Hsph1 APN 5 149618454 missense possibly damaging 0.47
IGL00965:Hsph1 APN 5 149630804 missense probably damaging 1.00
IGL01529:Hsph1 APN 5 149636034 missense probably benign 0.01
IGL01613:Hsph1 APN 5 149627278 missense probably benign 0.34
IGL02023:Hsph1 APN 5 149633859 missense probably damaging 1.00
IGL02272:Hsph1 APN 5 149617530 missense probably benign 0.00
IGL02754:Hsph1 APN 5 149623592 missense possibly damaging 0.95
R0666:Hsph1 UTSW 5 149631502 missense probably damaging 1.00
R1061:Hsph1 UTSW 5 149618418 missense possibly damaging 0.93
R1163:Hsph1 UTSW 5 149630801 missense probably damaging 1.00
R1511:Hsph1 UTSW 5 149630383 missense probably benign 0.03
R1794:Hsph1 UTSW 5 149630773 missense probably damaging 1.00
R1806:Hsph1 UTSW 5 149629989 missense probably damaging 0.99
R1847:Hsph1 UTSW 5 149623485 nonsense probably null
R2143:Hsph1 UTSW 5 149631486 missense probably damaging 0.99
R2144:Hsph1 UTSW 5 149630337 critical splice donor site probably null
R2917:Hsph1 UTSW 5 149630786 nonsense probably null
R3840:Hsph1 UTSW 5 149620715 intron probably null
R3841:Hsph1 UTSW 5 149620715 intron probably null
R4378:Hsph1 UTSW 5 149636007 nonsense probably null
R4577:Hsph1 UTSW 5 149618843 missense probably benign 0.03
R4618:Hsph1 UTSW 5 149618843 missense probably benign 0.03
R4621:Hsph1 UTSW 5 149618843 missense probably benign 0.03
R5898:Hsph1 UTSW 5 149625158 missense probably damaging 1.00
R6114:Hsph1 UTSW 5 149627387 missense possibly damaging 0.53
R6185:Hsph1 UTSW 5 149617695 missense probably damaging 1.00
R6432:Hsph1 UTSW 5 149618976 missense probably damaging 0.99
R7014:Hsph1 UTSW 5 149630400 missense probably damaging 1.00
R7189:Hsph1 UTSW 5 149630460 missense probably damaging 1.00
R7438:Hsph1 UTSW 5 149619020 missense probably damaging 1.00
R7502:Hsph1 UTSW 5 149630373 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGAATTAAGGCAGGCAGTG -3'
(R):5'- ATGTGGCCTAGGATCCTTGC -3'

Sequencing Primer
(F):5'- AGGCAGTGCTGGTCCAG -3'
(R):5'- GGCCTAGGATCCTTGCTGAATAAATG -3'
Posted On2018-07-23