Incidental Mutation 'R6678:Slc6a1'
ID527345
Institutional Source Beutler Lab
Gene Symbol Slc6a1
Ensembl Gene ENSMUSG00000030310
Gene Namesolute carrier family 6 (neurotransmitter transporter, GABA), member 1
SynonymsGat1, XT-1, Xtrp1, GAT-1, Gabt1, Gabt
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R6678 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location114282635-114317532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114307776 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 81 (K81R)
Ref Sequence ENSEMBL: ENSMUSP00000145080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032454] [ENSMUST00000204074]
Predicted Effect probably benign
Transcript: ENSMUST00000032454
AA Change: K265R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032454
Gene: ENSMUSG00000030310
AA Change: K265R

DomainStartEndE-ValueType
Pfam:SNF 44 559 6.1e-235 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204074
AA Change: K81R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000145080
Gene: ENSMUSG00000030310
AA Change: K81R

DomainStartEndE-ValueType
Pfam:SNF 1 375 1.2e-162 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204600
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a gamma-aminobutyric acid (GABA) transporter that localizes to the plasma membrane. The encoded protein removes GABA from the synaptic cleft, restoring it to presynaptic terminals. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous hypomorphic mice display abnormal inhibitory postsynaptic currents, and abnormal GABA uptake and release. Null mice show hyperactivity and various behavioral abnormalities, as well as an aversion to bitter taste. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,460,810 N644S possibly damaging Het
Agl C A 3: 116,753,320 V1294F probably damaging Het
Ash2l A C 8: 25,833,777 W125G probably damaging Het
Dap C T 15: 31,273,250 T51M probably benign Het
Dnah12 G A 14: 26,735,692 R871H probably damaging Het
Filip1l T C 16: 57,569,970 I307T probably benign Het
Gdap1l1 T A 2: 163,438,654 S37T probably benign Het
Gm43302 G T 5: 105,290,954 Q23K probably benign Het
Gm8765 A G 13: 50,701,910 K528R probably benign Het
Golga2 T C 2: 32,299,060 V227A probably damaging Het
Gramd4 A T 15: 86,091,503 S74C probably damaging Het
Gramd4 G C 15: 86,091,504 S74T possibly damaging Het
Hsph1 A C 5: 149,618,497 S755A probably benign Het
Inppl1 A G 7: 101,832,270 V235A probably damaging Het
Kcnc1 A G 7: 46,397,805 H43R probably benign Het
Klhl41 T G 2: 69,670,844 S216R probably benign Het
Kmt2e A G 5: 23,499,295 E1162G possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Ms4a13 T C 19: 11,183,858 I106V probably benign Het
Myo1f G A 17: 33,575,845 D20N probably damaging Het
Ndel1 T C 11: 68,833,413 T245A possibly damaging Het
Olfr1042 A T 2: 86,160,185 F62I probably damaging Het
P2rx6 C A 16: 17,570,956 N360K probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Plcl1 A G 1: 55,695,776 K92R probably benign Het
Prelp C T 1: 133,914,775 D211N probably benign Het
Rgl1 T C 1: 152,524,724 Y677C probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rreb1 G T 13: 37,899,699 D113Y probably damaging Het
Sf1 T A 19: 6,374,513 probably null Het
Sh3bp1 T C 15: 78,908,514 probably null Het
Shprh T A 10: 11,166,545 D757E probably benign Het
Ttc22 T A 4: 106,623,045 S165R probably benign Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vwa7 C A 17: 35,019,800 A288D probably damaging Het
Wdpcp A G 11: 21,721,105 I449V probably benign Het
Wdsub1 G A 2: 59,862,631 T313I probably benign Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in Slc6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Slc6a1 APN 6 114314465 splice site probably null
IGL01604:Slc6a1 APN 6 114314401 missense probably damaging 1.00
IGL02004:Slc6a1 APN 6 114314325 missense probably benign 0.35
IGL02437:Slc6a1 APN 6 114308617 missense probably damaging 1.00
IGL02553:Slc6a1 APN 6 114302490 intron probably benign
lewis UTSW 6 114307770 missense probably damaging 1.00
R0178:Slc6a1 UTSW 6 114304852 missense possibly damaging 0.82
R0238:Slc6a1 UTSW 6 114302800 missense probably benign 0.13
R0238:Slc6a1 UTSW 6 114302800 missense probably benign 0.13
R0239:Slc6a1 UTSW 6 114302800 missense probably benign 0.13
R0239:Slc6a1 UTSW 6 114302800 missense probably benign 0.13
R0408:Slc6a1 UTSW 6 114302800 missense probably benign 0.13
R1165:Slc6a1 UTSW 6 114311829 missense probably damaging 1.00
R1451:Slc6a1 UTSW 6 114307795 nonsense probably null
R1535:Slc6a1 UTSW 6 114307770 missense probably damaging 1.00
R1568:Slc6a1 UTSW 6 114307770 missense probably damaging 1.00
R1900:Slc6a1 UTSW 6 114311854 missense possibly damaging 0.50
R2011:Slc6a1 UTSW 6 114307770 missense probably damaging 1.00
R2134:Slc6a1 UTSW 6 114302016 missense probably benign
R2139:Slc6a1 UTSW 6 114304061 missense possibly damaging 0.77
R2152:Slc6a1 UTSW 6 114307770 missense probably damaging 1.00
R2154:Slc6a1 UTSW 6 114307770 missense probably damaging 1.00
R2207:Slc6a1 UTSW 6 114308671 missense probably damaging 1.00
R4627:Slc6a1 UTSW 6 114308106 missense probably benign
R4690:Slc6a1 UTSW 6 114302831 missense probably damaging 0.99
R4706:Slc6a1 UTSW 6 114307752 missense possibly damaging 0.95
R4886:Slc6a1 UTSW 6 114302533 missense possibly damaging 0.94
R4974:Slc6a1 UTSW 6 114307701 missense probably damaging 0.97
R5219:Slc6a1 UTSW 6 114310221 missense probably benign 0.18
R5354:Slc6a1 UTSW 6 114302623 missense possibly damaging 0.46
R5361:Slc6a1 UTSW 6 114302532 missense probably benign 0.00
R6448:Slc6a1 UTSW 6 114302086 missense possibly damaging 0.82
R6941:Slc6a1 UTSW 6 114313512 nonsense probably null
R7347:Slc6a1 UTSW 6 114311818 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAGGCTAGAAATCCAGGGATG -3'
(R):5'- GAACTGATCAAGGTCAGAGTCGAC -3'

Sequencing Primer
(F):5'- CTAGAAATCCAGGGATGGGGCG -3'
(R):5'- AGGTCAGAGTCGACATCTTCATCG -3'
Posted On2018-07-23