Incidental Mutation 'R6678:Wdpcp'
List |< first << previous [record 37 of 39] next >> last >|
ID527352
Institutional Source Beutler Lab
Gene Symbol Wdpcp
Ensembl Gene ENSMUSG00000020319
Gene NameWD repeat containing planar cell polarity effector
SynonymsAV249152, homoloc-13
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R6678 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location21572235-21898989 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21721105 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 449 (I449V)
Ref Sequence ENSEMBL: ENSMUSP00000020568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020568]
Predicted Effect probably benign
Transcript: ENSMUST00000020568
AA Change: I449V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020568
Gene: ENSMUSG00000020319
AA Change: I449V

DomainStartEndE-ValueType
Pfam:DUF3312 48 591 4.4e-278 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156624
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic WD40 repeat protein. A similar gene in frogs encodes a planar cell polarity protein that plays a critical role in collective cell movement and ciliogenesis by mediating septin localization. Mutations in this gene are associated with Bardet-Biedl syndrome 15 and may also play a role in Meckel-Gruber syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a null mutation display ciliogenesis defects, anophthalmia, cysts in multiple tissues, central polydactyly, duplex kidney, and septation defects in the outflow tract and cloaca. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,460,810 N644S possibly damaging Het
Agl C A 3: 116,753,320 V1294F probably damaging Het
Ash2l A C 8: 25,833,777 W125G probably damaging Het
Dap C T 15: 31,273,250 T51M probably benign Het
Dnah12 G A 14: 26,735,692 R871H probably damaging Het
Filip1l T C 16: 57,569,970 I307T probably benign Het
Gdap1l1 T A 2: 163,438,654 S37T probably benign Het
Gm43302 G T 5: 105,290,954 Q23K probably benign Het
Gm8765 A G 13: 50,701,910 K528R probably benign Het
Golga2 T C 2: 32,299,060 V227A probably damaging Het
Gramd4 A T 15: 86,091,503 S74C probably damaging Het
Gramd4 G C 15: 86,091,504 S74T possibly damaging Het
Hsph1 A C 5: 149,618,497 S755A probably benign Het
Inppl1 A G 7: 101,832,270 V235A probably damaging Het
Kcnc1 A G 7: 46,397,805 H43R probably benign Het
Klhl41 T G 2: 69,670,844 S216R probably benign Het
Kmt2e A G 5: 23,499,295 E1162G possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Ms4a13 T C 19: 11,183,858 I106V probably benign Het
Myo1f G A 17: 33,575,845 D20N probably damaging Het
Ndel1 T C 11: 68,833,413 T245A possibly damaging Het
Olfr1042 A T 2: 86,160,185 F62I probably damaging Het
P2rx6 C A 16: 17,570,956 N360K probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Plcl1 A G 1: 55,695,776 K92R probably benign Het
Prelp C T 1: 133,914,775 D211N probably benign Het
Rgl1 T C 1: 152,524,724 Y677C probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rreb1 G T 13: 37,899,699 D113Y probably damaging Het
Sf1 T A 19: 6,374,513 probably null Het
Sh3bp1 T C 15: 78,908,514 probably null Het
Shprh T A 10: 11,166,545 D757E probably benign Het
Slc6a1 A G 6: 114,307,776 K81R probably benign Het
Ttc22 T A 4: 106,623,045 S165R probably benign Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vwa7 C A 17: 35,019,800 A288D probably damaging Het
Wdsub1 G A 2: 59,862,631 T313I probably benign Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in Wdpcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Wdpcp APN 11 21659995 missense probably damaging 1.00
IGL01322:Wdpcp APN 11 21711949 missense probably damaging 1.00
IGL01876:Wdpcp APN 11 21813383 missense possibly damaging 0.92
IGL01879:Wdpcp APN 11 21711630 missense probably damaging 0.99
IGL01913:Wdpcp APN 11 21748931 missense probably damaging 1.00
IGL02127:Wdpcp APN 11 21711958 missense possibly damaging 0.71
IGL03326:Wdpcp APN 11 21885048 missense probably benign 0.05
R0040:Wdpcp UTSW 11 21711638 missense probably damaging 1.00
R0040:Wdpcp UTSW 11 21711638 missense probably damaging 1.00
R0142:Wdpcp UTSW 11 21857444 splice site probably null
R2159:Wdpcp UTSW 11 21857476 missense probably benign 0.01
R2163:Wdpcp UTSW 11 21885015 nonsense probably null
R2165:Wdpcp UTSW 11 21691884 missense probably damaging 1.00
R4239:Wdpcp UTSW 11 21695269 missense probably damaging 1.00
R4239:Wdpcp UTSW 11 21695271 missense probably benign 0.35
R4636:Wdpcp UTSW 11 21711568 missense probably benign 0.03
R5558:Wdpcp UTSW 11 21711732 missense probably benign 0.00
R6493:Wdpcp UTSW 11 21711631 missense possibly damaging 0.83
R6762:Wdpcp UTSW 11 21721244 missense probably benign 0.11
R6957:Wdpcp UTSW 11 21721154 missense possibly damaging 0.94
R7380:Wdpcp UTSW 11 21711585 missense possibly damaging 0.52
R7458:Wdpcp UTSW 11 21748919 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGTTTCAAGTGCCATCAGCC -3'
(R):5'- TGAGCCTCTGTCTAAGAAGATG -3'

Sequencing Primer
(F):5'- TGCCATCAGCCTTTTATAAATAAAAC -3'
(R):5'- CCTCTGTCTAAGAAGATGGTTCACG -3'
Posted On2018-07-23