Incidental Mutation 'R6678:Dap'
ID527358
Institutional Source Beutler Lab
Gene Symbol Dap
Ensembl Gene ENSMUSG00000039168
Gene Namedeath-associated protein
Synonyms4921531N22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6678 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location31224314-31274341 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31273250 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 51 (T51M)
Ref Sequence ENSEMBL: ENSMUSP00000141108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044524] [ENSMUST00000068987] [ENSMUST00000185618] [ENSMUST00000186109] [ENSMUST00000186425] [ENSMUST00000186547]
Predicted Effect silent
Transcript: ENSMUST00000044524
SMART Domains Protein: ENSMUSP00000047186
Gene: ENSMUSG00000039168

DomainStartEndE-ValueType
Pfam:DAP 12 102 3.3e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000068987
SMART Domains Protein: ENSMUSP00000125904
Gene: ENSMUSG00000055416

DomainStartEndE-ValueType
Pfam:DUF842 5 132 2.4e-48 PFAM
Predicted Effect silent
Transcript: ENSMUST00000185618
SMART Domains Protein: ENSMUSP00000140568
Gene: ENSMUSG00000039168

DomainStartEndE-ValueType
Pfam:DAP 3 62 4.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186109
AA Change: T51M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect silent
Transcript: ENSMUST00000186425
SMART Domains Protein: ENSMUSP00000140007
Gene: ENSMUSG00000039168

DomainStartEndE-ValueType
Pfam:DAP 1 79 6.5e-20 PFAM
Predicted Effect silent
Transcript: ENSMUST00000186547
SMART Domains Protein: ENSMUSP00000140481
Gene: ENSMUSG00000039168

DomainStartEndE-ValueType
Pfam:DAP 1 79 6.5e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basic, proline-rich, 15-kD protein. The protein acts as a positive mediator of programmed cell death that is induced by interferon-gamma. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,460,810 N644S possibly damaging Het
Agl C A 3: 116,753,320 V1294F probably damaging Het
Ash2l A C 8: 25,833,777 W125G probably damaging Het
Dnah12 G A 14: 26,735,692 R871H probably damaging Het
Filip1l T C 16: 57,569,970 I307T probably benign Het
Gdap1l1 T A 2: 163,438,654 S37T probably benign Het
Gm43302 G T 5: 105,290,954 Q23K probably benign Het
Gm8765 A G 13: 50,701,910 K528R probably benign Het
Golga2 T C 2: 32,299,060 V227A probably damaging Het
Gramd4 A T 15: 86,091,503 S74C probably damaging Het
Gramd4 G C 15: 86,091,504 S74T possibly damaging Het
Hsph1 A C 5: 149,618,497 S755A probably benign Het
Inppl1 A G 7: 101,832,270 V235A probably damaging Het
Kcnc1 A G 7: 46,397,805 H43R probably benign Het
Klhl41 T G 2: 69,670,844 S216R probably benign Het
Kmt2e A G 5: 23,499,295 E1162G possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Ms4a13 T C 19: 11,183,858 I106V probably benign Het
Myo1f G A 17: 33,575,845 D20N probably damaging Het
Ndel1 T C 11: 68,833,413 T245A possibly damaging Het
Olfr1042 A T 2: 86,160,185 F62I probably damaging Het
P2rx6 C A 16: 17,570,956 N360K probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Plcl1 A G 1: 55,695,776 K92R probably benign Het
Prelp C T 1: 133,914,775 D211N probably benign Het
Rgl1 T C 1: 152,524,724 Y677C probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rreb1 G T 13: 37,899,699 D113Y probably damaging Het
Sf1 T A 19: 6,374,513 probably null Het
Sh3bp1 T C 15: 78,908,514 probably null Het
Shprh T A 10: 11,166,545 D757E probably benign Het
Slc6a1 A G 6: 114,307,776 K81R probably benign Het
Ttc22 T A 4: 106,623,045 S165R probably benign Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vwa7 C A 17: 35,019,800 A288D probably damaging Het
Wdpcp A G 11: 21,721,105 I449V probably benign Het
Wdsub1 G A 2: 59,862,631 T313I probably benign Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in Dap
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0904:Dap UTSW 15 31272380 splice site probably benign
R6262:Dap UTSW 15 31235814 missense probably benign
R6651:Dap UTSW 15 31273207 missense probably damaging 1.00
R7242:Dap UTSW 15 31273308 makesense probably null
R7376:Dap UTSW 15 31235839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCAAGCCACAATAGTAGTCC -3'
(R):5'- GAGGCCCATGTTGCTTTGTC -3'

Sequencing Primer
(F):5'- TGCAAGCCACAATAGTAGTCCACTAC -3'
(R):5'- TGTAGTAAACTCTGTGGGAAGTAC -3'
Posted On2018-07-23