Mutagenetix > Incidental Mutations

Incidental Mutation 'R6678:Gramd4'

527360

Institutional Source

Beutler Lab

Gene Symbol

Gramd4

Ensembl Gene

ENSMUSG00000035900

Gene Name

GRAM domain containing 4

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6678 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86057695-86137634 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 86091503 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 74 (S74C)

Ref Sequence

ENSEMBL: ENSMUSP00000120796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088931] [ENSMUST00000123349] [ENSMUST00000138134]

AlphaFold

Q8CB44

Predicted Effect

possibly damaging
Transcript: ENSMUST00000088931
AA Change: S99C

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000086321
Gene: ENSMUSG00000035900
AA Change: S99C

Domain	Start	End	E-Value	Type
coiled coil region	132	190	N/A	INTRINSIC
transmembrane domain	301	323	N/A	INTRINSIC
transmembrane domain	400	422	N/A	INTRINSIC
GRAM	500	578	8.41e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000123349
AA Change: S74C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000117468
Gene: ENSMUSG00000035900
AA Change: S74C

Domain	Start	End	E-Value	Type
coiled coil region	107	165	N/A	INTRINSIC
transmembrane domain	276	298	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123474

Predicted Effect

probably damaging
Transcript: ENSMUST00000138134
AA Change: S74C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000120796
Gene: ENSMUSG00000035900
AA Change: S74C

Domain	Start	End	E-Value	Type
coiled coil region	107	165	N/A	INTRINSIC
transmembrane domain	276	298	N/A	INTRINSIC
transmembrane domain	375	397	N/A	INTRINSIC
GRAM	475	553	3.86e-20	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147286

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159271

Meta Mutation Damage Score

0.0651

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 96.1%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GRAMD4 is a mitochondrial effector of E2F1 (MIM 189971)-induced apoptosis (Stanelle et al., 2005 [PubMed 15565177]).[supplied by OMIM, Jan 2011]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb3	T	C	1: 25,460,810	N644S	possibly damaging	Het
Agl	C	A	3: 116,753,320	V1294F	probably damaging	Het
Ash2l	A	C	8: 25,833,777	W125G	probably damaging	Het
Dap	C	T	15: 31,273,250	T51M	probably benign	Het
Dnah12	G	A	14: 26,735,692	R871H	probably damaging	Het
Filip1l	T	C	16: 57,569,970	I307T	probably benign	Het
Gdap1l1	T	A	2: 163,438,654	S37T	probably benign	Het
Gm43302	G	T	5: 105,290,954	Q23K	probably benign	Het
Gm8765	A	G	13: 50,701,910	K528R	probably benign	Het
Golga2	T	C	2: 32,299,060	V227A	probably damaging	Het
Hsph1	A	C	5: 149,618,497	S755A	probably benign	Het
Inppl1	A	G	7: 101,832,270	V235A	probably damaging	Het
Kcnc1	A	G	7: 46,397,805	H43R	probably benign	Het
Klhl41	T	G	2: 69,670,844	S216R	probably benign	Het
Kmt2e	A	G	5: 23,499,295	E1162G	possibly damaging	Het
Lrp1	G	A	10: 127,560,136	H2422Y	probably damaging	Het
Ms4a13	T	C	19: 11,183,858	I106V	probably benign	Het
Myo1f	G	A	17: 33,575,845	D20N	probably damaging	Het
Ndel1	T	C	11: 68,833,413	T245A	possibly damaging	Het
Olfr1042	A	T	2: 86,160,185	F62I	probably damaging	Het
P2rx6	C	A	16: 17,570,956	N360K	probably benign	Het
Pcdhgb5	C	T	18: 37,731,202	L17F	probably damaging	Het
Plcl1	A	G	1: 55,695,776	K92R	probably benign	Het
Prelp	C	T	1: 133,914,775	D211N	probably benign	Het
Rgl1	T	C	1: 152,524,724	Y677C	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rreb1	G	T	13: 37,899,699	D113Y	probably damaging	Het
Sf1	T	A	19: 6,374,513		probably null	Het
Sh3bp1	T	C	15: 78,908,514		probably null	Het
Shprh	T	A	10: 11,166,545	D757E	probably benign	Het
Slc6a1	A	G	6: 114,307,776	K81R	probably benign	Het
Ttc22	T	A	4: 106,623,045	S165R	probably benign	Het
Vmn1r113	G	A	7: 20,787,978	G232S	probably benign	Het
Vwa7	C	A	17: 35,019,800	A288D	probably damaging	Het
Wdpcp	A	G	11: 21,721,105	I449V	probably benign	Het
Wdsub1	G	A	2: 59,862,631	T313I	probably benign	Het
Zyg11a	A	G	4: 108,189,681	V532A	probably benign	Het

Other mutations in Gramd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02983:Gramd4	APN	15	86127018	missense	probably damaging	0.97
Grasping	UTSW	15	86091503	missense	probably damaging	0.99
R0053:Gramd4	UTSW	15	86130138	splice site	probably benign
R0622:Gramd4	UTSW	15	86091389	missense	probably damaging	1.00
R1401:Gramd4	UTSW	15	86125196	missense	probably damaging	1.00
R1741:Gramd4	UTSW	15	86091529	splice site	probably null
R1840:Gramd4	UTSW	15	86130192	critical splice donor site	probably null
R1968:Gramd4	UTSW	15	86132905	missense	probably damaging	1.00
R2909:Gramd4	UTSW	15	86122183	nonsense	probably null
R4345:Gramd4	UTSW	15	86134893	missense	probably damaging	1.00
R4431:Gramd4	UTSW	15	86130160	missense	probably damaging	1.00
R4832:Gramd4	UTSW	15	86134856	missense	probably benign
R5164:Gramd4	UTSW	15	86100831	missense	probably benign	0.16
R5216:Gramd4	UTSW	15	86134785	critical splice acceptor site	probably null
R5898:Gramd4	UTSW	15	86100784	missense	probably damaging	1.00
R5959:Gramd4	UTSW	15	86127557	missense	probably damaging	0.99
R6303:Gramd4	UTSW	15	86134919	missense	possibly damaging	0.72
R6304:Gramd4	UTSW	15	86134919	missense	possibly damaging	0.72
R6678:Gramd4	UTSW	15	86091504	missense	possibly damaging	0.52
R6980:Gramd4	UTSW	15	86131969	missense	probably benign	0.17
R7371:Gramd4	UTSW	15	86135406	missense	probably benign	0.04
R7557:Gramd4	UTSW	15	86100900	nonsense	probably null
R7922:Gramd4	UTSW	15	86131958	missense	probably benign	0.07
R8874:Gramd4	UTSW	15	86100892	missense	probably damaging	0.97
R9127:Gramd4	UTSW	15	86091324	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGCAGCTAGTGATGTGCTTC -3'
(R):5'- GAGAATTGGGCGTGTCTAAATTGC -3'

Sequencing Primer
(F):5'- GCAGCTAGTGATGTGCTTCATTCATC -3'
(R):5'- CCTGGTCAGGCATGAATCTTC -3'

Posted On

2018-07-23