Incidental Mutation 'R6678:Ms4a13'
List |< first << previous [record 19 of 39] next >> last >|
ID527367
Institutional Source Beutler Lab
Gene Symbol Ms4a13
Ensembl Gene ENSMUSG00000057240
Gene Namemembrane-spanning 4-domains, subfamily A, member 13
Synonyms1700060E18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6678 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location11169418-11196737 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11183858 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 106 (I106V)
Ref Sequence ENSEMBL: ENSMUSP00000140293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073380] [ENSMUST00000188464]
Predicted Effect probably benign
Transcript: ENSMUST00000073380
AA Change: I106V

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000073095
Gene: ENSMUSG00000057240
AA Change: I106V

DomainStartEndE-ValueType
Pfam:CD20 15 137 6.3e-10 PFAM
transmembrane domain 139 161 N/A INTRINSIC
low complexity region 189 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188464
AA Change: I106V

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140293
Gene: ENSMUSG00000057240
AA Change: I106V

DomainStartEndE-ValueType
Pfam:CD20 15 152 2.1e-24 PFAM
low complexity region 160 171 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,460,810 N644S possibly damaging Het
Agl C A 3: 116,753,320 V1294F probably damaging Het
Ash2l A C 8: 25,833,777 W125G probably damaging Het
Dap C T 15: 31,273,250 T51M probably benign Het
Dnah12 G A 14: 26,735,692 R871H probably damaging Het
Filip1l T C 16: 57,569,970 I307T probably benign Het
Gdap1l1 T A 2: 163,438,654 S37T probably benign Het
Gm43302 G T 5: 105,290,954 Q23K probably benign Het
Gm8765 A G 13: 50,701,910 K528R probably benign Het
Golga2 T C 2: 32,299,060 V227A probably damaging Het
Gramd4 A T 15: 86,091,503 S74C probably damaging Het
Gramd4 G C 15: 86,091,504 S74T possibly damaging Het
Hsph1 A C 5: 149,618,497 S755A probably benign Het
Inppl1 A G 7: 101,832,270 V235A probably damaging Het
Kcnc1 A G 7: 46,397,805 H43R probably benign Het
Klhl41 T G 2: 69,670,844 S216R probably benign Het
Kmt2e A G 5: 23,499,295 E1162G possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Myo1f G A 17: 33,575,845 D20N probably damaging Het
Ndel1 T C 11: 68,833,413 T245A possibly damaging Het
Olfr1042 A T 2: 86,160,185 F62I probably damaging Het
P2rx6 C A 16: 17,570,956 N360K probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Plcl1 A G 1: 55,695,776 K92R probably benign Het
Prelp C T 1: 133,914,775 D211N probably benign Het
Rgl1 T C 1: 152,524,724 Y677C probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rreb1 G T 13: 37,899,699 D113Y probably damaging Het
Sf1 T A 19: 6,374,513 probably null Het
Sh3bp1 T C 15: 78,908,514 probably null Het
Shprh T A 10: 11,166,545 D757E probably benign Het
Slc6a1 A G 6: 114,307,776 K81R probably benign Het
Ttc22 T A 4: 106,623,045 S165R probably benign Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vwa7 C A 17: 35,019,800 A288D probably damaging Het
Wdpcp A G 11: 21,721,105 I449V probably benign Het
Wdsub1 G A 2: 59,862,631 T313I probably benign Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in Ms4a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Ms4a13 APN 19 11185114 missense probably damaging 1.00
IGL02458:Ms4a13 APN 19 11171928 missense probably benign
IGL03259:Ms4a13 APN 19 11183846 missense probably damaging 0.99
R0465:Ms4a13 UTSW 19 11172593 missense probably benign 0.42
R0539:Ms4a13 UTSW 19 11171871 intron probably benign
R1327:Ms4a13 UTSW 19 11183887 missense probably damaging 1.00
R1500:Ms4a13 UTSW 19 11183861 missense probably damaging 1.00
R5859:Ms4a13 UTSW 19 11183916 nonsense probably null
R5888:Ms4a13 UTSW 19 11191506 missense probably benign 0.01
R5940:Ms4a13 UTSW 19 11192966 missense possibly damaging 0.83
R6568:Ms4a13 UTSW 19 11191559 missense probably damaging 1.00
R6597:Ms4a13 UTSW 19 11192939 missense probably benign
R6919:Ms4a13 UTSW 19 11171885 missense probably benign 0.00
R7596:Ms4a13 UTSW 19 11169965 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGCACAAAATAGTCTCCACTGG -3'
(R):5'- AAGCACATGTCGAAAGCTTC -3'

Sequencing Primer
(F):5'- CACAAAATAGTCTCCACTGGTTATTG -3'
(R):5'- TGTCGAAAGCTTCACAAACTAC -3'
Posted On2018-07-23