Incidental Mutation 'R6679:Peg10'
ID527385
Institutional Source Beutler Lab
Gene Symbol Peg10
Ensembl Gene ENSMUSG00000092035
Gene Namepaternally expressed 10
SynonymsHB-1, MyEF-3, Mart2, Mar2, MyEF-3 like, MEF3L, Edr
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6679 (G1)
Quality Score113.467
Status Validated
Chromosome6
Chromosomal Location4747306-4760517 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) CCAACAACAACAACAACAACAACA to CCAACAACAACAACAACAACA at 4754276 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166678] [ENSMUST00000176204] [ENSMUST00000176551]
Predicted Effect probably benign
Transcript: ENSMUST00000166678
SMART Domains Protein: ENSMUSP00000127306
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:DUF4939 130 220 6.1e-17 PFAM
Pfam:Retrotrans_gag 174 267 2.9e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
low complexity region 368 379 N/A INTRINSIC
low complexity region 541 610 N/A INTRINSIC
low complexity region 621 660 N/A INTRINSIC
low complexity region 663 785 N/A INTRINSIC
Blast:SERPIN 798 910 1e-5 BLAST
low complexity region 923 936 N/A INTRINSIC
low complexity region 972 998 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176204
SMART Domains Protein: ENSMUSP00000134963
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:Retrotrans_gag 174 267 1.3e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176551
SMART Domains Protein: ENSMUSP00000135076
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 173 242 N/A INTRINSIC
low complexity region 253 292 N/A INTRINSIC
low complexity region 295 417 N/A INTRINSIC
Blast:SERPIN 430 542 6e-6 BLAST
low complexity region 555 568 N/A INTRINSIC
low complexity region 604 630 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: This is a paternally expressed imprinted gene that is thought to have been derived from the Ty3/Gypsy family of retrotransposons. It contains two overlapping open reading frames, RF1 and RF2, and expresses two proteins: a shorter, gag-like protein (with a CCHC-type zinc finger domain) from RF1; and a longer, gag/pol-like fusion protein (with an additional aspartic protease motif) from RF1/RF2 by -1 translational frameshifting (-1 FS). While -1 FS has been observed in RNA viruses and transposons in both prokaryotes and eukaryotes, this gene represents the first example of -1 FS in a eukaryotic cellular gene. This gene is highly conserved across mammalian species and retains the heptanucleotide (GGGAAAC) and pseudoknot elements required for -1 FS. It is expressed in adult and embryonic tissues (most notably in placenta) and reported to have a role in cell proliferation, differentiation, apoptosis and cancer development. Knockout mice lacking this gene showed early embryonic lethality with placental defects, indicating the importance of this gene in embryonic development. [provided by RefSeq, Oct 2014]
PHENOTYPE: Heterozygous mice with a paternally inherited null allele display embryonic lethality during organogenesis with abnormal placental development. Heterozygous mice with a maternally inherited null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T A 5: 146,504,940 V299E probably damaging Het
Adgrb3 T C 1: 25,131,296 I767V probably benign Het
Ahnak2 G A 12: 112,772,976 T748I probably damaging Het
Aoc3 T A 11: 101,331,453 L129M probably damaging Het
Arhgef7 T A 8: 11,824,667 M540K possibly damaging Het
Bod1l T A 5: 41,816,666 K2435M probably damaging Het
Col11a1 A G 3: 114,152,719 probably null Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Creb5 G T 6: 53,685,469 M250I possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dock10 A G 1: 80,566,797 I557T probably benign Het
Efcab2 G A 1: 178,437,404 A12T probably benign Het
Ehd1 A G 19: 6,294,444 N245D probably benign Het
Erich3 T A 3: 154,762,429 D839E possibly damaging Het
Fam13b T C 18: 34,487,022 T270A possibly damaging Het
Fat2 A T 11: 55,309,305 L981Q probably damaging Het
Fgfrl1 G A 5: 108,704,972 W89* probably null Het
Fgfrl1 G T 5: 108,704,973 W89C probably damaging Het
Gm10770 G A 2: 150,179,649 P11S probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Hdac3 A G 18: 37,944,933 V190A possibly damaging Het
Htr1a A G 13: 105,445,428 N392S probably damaging Het
Ift43 A G 12: 86,138,818 M59V probably benign Het
Jakmip2 T C 18: 43,565,949 T482A probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nme8 A T 13: 19,690,970 probably null Het
Olfr196 A G 16: 59,167,846 I99T probably benign Het
Plec A G 15: 76,173,815 F3996S probably damaging Het
Ppfia4 A T 1: 134,309,679 Y961N probably damaging Het
Rag1 G A 2: 101,644,284 P171L probably damaging Het
Rbm24 A T 13: 46,418,992 probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Rxfp3 T C 15: 11,035,870 Y472C probably damaging Het
Sash1 T A 10: 8,740,185 I638F probably damaging Het
Sh3glb2 G A 2: 30,350,619 R145W probably damaging Het
Ston2 G T 12: 91,648,096 P513T probably damaging Het
Sycp2 A G 2: 178,380,928 M470T probably damaging Het
Syt10 C A 15: 89,814,371 D257Y probably damaging Het
Tcfl5 G T 2: 180,635,262 L447I probably damaging Het
Tlr11 T C 14: 50,362,854 W766R probably benign Het
Usp33 T A 3: 152,368,487 D19E possibly damaging Het
Vmn1r123 T A 7: 21,162,943 Y253* probably null Het
Wdr55 G A 18: 36,763,124 G289D probably damaging Het
Zfp523 C T 17: 28,202,220 T235M probably damaging Het
Other mutations in Peg10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02029:Peg10 APN 6 4754473 utr 5 prime probably benign
IGL03063:Peg10 APN 6 4756647 utr 3 prime probably benign
piaggio UTSW 6 4756427 utr 3 prime probably benign
PIT4480001:Peg10 UTSW 6 4756560 missense unknown
R0090:Peg10 UTSW 6 4756063 utr 3 prime probably benign
R0148:Peg10 UTSW 6 4755711 missense possibly damaging 0.88
R0650:Peg10 UTSW 6 4756475 small insertion probably benign
R0698:Peg10 UTSW 6 4756835 utr 3 prime probably benign
R1600:Peg10 UTSW 6 4757080 utr 3 prime probably benign
R1842:Peg10 UTSW 6 4756381 utr 3 prime probably benign
R1930:Peg10 UTSW 6 4755778 missense probably damaging 0.99
R1931:Peg10 UTSW 6 4755778 missense probably damaging 0.99
R2162:Peg10 UTSW 6 4755914 utr 3 prime probably benign
R2215:Peg10 UTSW 6 4756918 utr 3 prime probably benign
R2339:Peg10 UTSW 6 4756102 utr 3 prime probably benign
R2847:Peg10 UTSW 6 4756912 utr 3 prime probably benign
R2848:Peg10 UTSW 6 4756912 utr 3 prime probably benign
R3000:Peg10 UTSW 6 4754276 utr 5 prime probably benign
R3056:Peg10 UTSW 6 4755029 missense possibly damaging 0.66
R4051:Peg10 UTSW 6 4754534 missense probably benign 0.00
R4059:Peg10 UTSW 6 4756427 utr 3 prime probably benign
R4296:Peg10 UTSW 6 4756472 small insertion probably benign
R4626:Peg10 UTSW 6 4756460 small insertion probably benign
R4634:Peg10 UTSW 6 4756452 small insertion probably benign
R4679:Peg10 UTSW 6 4756452 small insertion probably benign
R4834:Peg10 UTSW 6 4754294 utr 5 prime probably benign
R4982:Peg10 UTSW 6 4756451 small insertion probably benign
R4983:Peg10 UTSW 6 4756451 small insertion probably benign
R4996:Peg10 UTSW 6 4756454 small insertion probably benign
R4997:Peg10 UTSW 6 4756457 small insertion probably benign
R5015:Peg10 UTSW 6 4756453 small insertion probably benign
R5085:Peg10 UTSW 6 4755864 utr 3 prime probably benign
R5091:Peg10 UTSW 6 4754511 missense probably benign 0.01
R5231:Peg10 UTSW 6 4756939 utr 3 prime probably benign
R5278:Peg10 UTSW 6 4756442 small deletion probably benign
R5364:Peg10 UTSW 6 4756128 utr 3 prime probably benign
R5397:Peg10 UTSW 6 4756453 small insertion probably benign
R5485:Peg10 UTSW 6 4755565 missense probably benign 0.09
R5573:Peg10 UTSW 6 4755913 utr 3 prime probably benign
R5710:Peg10 UTSW 6 4756350 small insertion probably benign
R5710:Peg10 UTSW 6 4756351 small insertion probably benign
R5736:Peg10 UTSW 6 4754423 missense probably benign 0.00
R5865:Peg10 UTSW 6 4754375 missense probably damaging 0.98
R6056:Peg10 UTSW 6 4756449 small insertion probably benign
R6116:Peg10 UTSW 6 4756351 small insertion probably benign
R6129:Peg10 UTSW 6 4756449 small insertion probably benign
R6147:Peg10 UTSW 6 4754499 start gained probably benign
R6171:Peg10 UTSW 6 4756449 small insertion probably benign
R6194:Peg10 UTSW 6 4756351 small insertion probably benign
R6197:Peg10 UTSW 6 4756452 small insertion probably benign
R6207:Peg10 UTSW 6 4756449 small insertion probably benign
R6215:Peg10 UTSW 6 4756452 small insertion probably benign
R6276:Peg10 UTSW 6 4756449 small insertion probably benign
R6281:Peg10 UTSW 6 4756449 small insertion probably benign
R6287:Peg10 UTSW 6 4756451 small insertion probably benign
R6302:Peg10 UTSW 6 4756449 small insertion probably benign
R6393:Peg10 UTSW 6 4756452 small insertion probably benign
R6394:Peg10 UTSW 6 4756451 small insertion probably benign
R6405:Peg10 UTSW 6 4756453 small insertion probably benign
R6421:Peg10 UTSW 6 4756449 small insertion probably benign
R6486:Peg10 UTSW 6 4756449 small insertion probably benign
R6538:Peg10 UTSW 6 4756449 small insertion probably benign
R6668:Peg10 UTSW 6 4754502 missense probably benign 0.01
R6685:Peg10 UTSW 6 4754738 missense probably damaging 1.00
R6702:Peg10 UTSW 6 4756452 small insertion probably benign
R6706:Peg10 UTSW 6 4756452 small insertion probably benign
R6747:Peg10 UTSW 6 4757137 utr 3 prime probably benign
R6775:Peg10 UTSW 6 4756452 small insertion probably benign
R6811:Peg10 UTSW 6 4756451 small insertion probably benign
R6823:Peg10 UTSW 6 4756431 small deletion probably benign
R6826:Peg10 UTSW 6 4756353 small insertion probably benign
R6847:Peg10 UTSW 6 4754279 utr 5 prime probably benign
R6861:Peg10 UTSW 6 4756350 small insertion probably benign
R6861:Peg10 UTSW 6 4756351 small insertion probably benign
R6876:Peg10 UTSW 6 4756451 small insertion probably benign
R6891:Peg10 UTSW 6 4756449 small insertion probably benign
R6911:Peg10 UTSW 6 4756452 small insertion probably benign
R6973:Peg10 UTSW 6 4756431 small deletion probably benign
R6990:Peg10 UTSW 6 4756451 small insertion probably benign
R6998:Peg10 UTSW 6 4756398 small deletion probably benign
R7070:Peg10 UTSW 6 4756454 small insertion probably benign
R7120:Peg10 UTSW 6 4756398 small deletion probably benign
R7132:Peg10 UTSW 6 4756398 small deletion probably benign
R7140:Peg10 UTSW 6 4756452 small insertion probably benign
R7189:Peg10 UTSW 6 4756431 small deletion probably benign
R7208:Peg10 UTSW 6 4756398 small deletion probably benign
R7256:Peg10 UTSW 6 4756398 small deletion probably benign
R7260:Peg10 UTSW 6 4756398 small deletion probably benign
R7261:Peg10 UTSW 6 4756591 missense unknown
R7401:Peg10 UTSW 6 4756452 small insertion probably benign
R7409:Peg10 UTSW 6 4756398 small deletion probably benign
R7439:Peg10 UTSW 6 4756453 small insertion probably benign
R7475:Peg10 UTSW 6 4756398 small deletion probably benign
R7483:Peg10 UTSW 6 4756451 small insertion probably benign
R7502:Peg10 UTSW 6 4756398 small deletion probably benign
R7515:Peg10 UTSW 6 4756452 small insertion probably benign
R7520:Peg10 UTSW 6 4756796 missense unknown
R7544:Peg10 UTSW 6 4756427 frame shift probably null
R7571:Peg10 UTSW 6 4756082 missense unknown
R7581:Peg10 UTSW 6 4756452 small insertion probably benign
R7635:Peg10 UTSW 6 4754938 missense probably damaging 0.99
R7677:Peg10 UTSW 6 4756398 small deletion probably benign
R7697:Peg10 UTSW 6 4756453 small insertion probably benign
R7710:Peg10 UTSW 6 4756452 small insertion probably benign
R7803:Peg10 UTSW 6 4756431 small deletion probably benign
R7816:Peg10 UTSW 6 4756453 small insertion probably benign
R7820:Peg10 UTSW 6 4756398 small deletion probably benign
R7827:Peg10 UTSW 6 4756452 small insertion probably benign
R7861:Peg10 UTSW 6 4756431 small deletion probably benign
R7881:Peg10 UTSW 6 4756454 small insertion probably benign
R7904:Peg10 UTSW 6 4756452 small insertion probably benign
R7915:Peg10 UTSW 6 4756451 small insertion probably benign
R7916:Peg10 UTSW 6 4756451 small insertion probably benign
R7963:Peg10 UTSW 6 4756452 small insertion probably benign
R8016:Peg10 UTSW 6 4756451 small insertion probably benign
R8037:Peg10 UTSW 6 4756398 small deletion probably benign
R8062:Peg10 UTSW 6 4756398 small deletion probably benign
R8081:Peg10 UTSW 6 4756452 small insertion probably benign
R8113:Peg10 UTSW 6 4756451 small insertion probably benign
R8115:Peg10 UTSW 6 4756707 missense unknown
R8140:Peg10 UTSW 6 4756113 missense unknown
R8178:Peg10 UTSW 6 4756452 small insertion probably benign
R8233:Peg10 UTSW 6 4756453 small insertion probably benign
R8239:Peg10 UTSW 6 4756452 small insertion probably benign
R8281:Peg10 UTSW 6 4756431 small deletion probably benign
R8310:Peg10 UTSW 6 4756454 small insertion probably benign
R8312:Peg10 UTSW 6 4756452 small insertion probably benign
R8330:Peg10 UTSW 6 4756452 small insertion probably benign
R8338:Peg10 UTSW 6 4756398 small deletion probably benign
R8387:Peg10 UTSW 6 4756452 small insertion probably benign
R8390:Peg10 UTSW 6 4756451 small insertion probably benign
X0065:Peg10 UTSW 6 4756515 utr 3 prime probably benign
Z1176:Peg10 UTSW 6 4756451 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GCTATTTGAACACCTAAATCCCTGC -3'
(R):5'- CTCTGTGCAAGCAACTCCAC -3'

Sequencing Primer
(F):5'- GCGACTGCTCTGAATGAATATG -3'
(R):5'- GTGCAAGCAACTCCACCTGATC -3'
Posted On2018-07-23