Incidental Mutation 'R6679:Sash1'
ID527391
Institutional Source Beutler Lab
Gene Symbol Sash1
Ensembl Gene ENSMUSG00000015305
Gene NameSAM and SH3 domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6679 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location8722219-8886070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8740185 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 638 (I638F)
Ref Sequence ENSEMBL: ENSMUSP00000015449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015449] [ENSMUST00000212869]
Predicted Effect probably damaging
Transcript: ENSMUST00000015449
AA Change: I638F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000015449
Gene: ENSMUSG00000015305
AA Change: I638F

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
coiled coil region 185 212 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
Pfam:SLY 394 548 1.2e-46 PFAM
SH3 550 607 1.16e-3 SMART
SAM 623 690 1.83e-11 SMART
low complexity region 1008 1021 N/A INTRINSIC
SAM 1157 1224 3.6e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212869
Meta Mutation Damage Score 0.2805 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein involved in the TLR4 signaling pathway that may stimulate cytokine production and endothelial cell migration in response to invading pathogens. The encoded protein has also been described as a potential tumor suppressor that may negatively regulate proliferation, apoptosis, and invasion of cancer cells, and reduced expression of this gene has been observed in multiple human cancers. Mutations in this gene may be associated with abnormal skin pigmentation in human patients. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T A 5: 146,504,940 V299E probably damaging Het
Adgrb3 T C 1: 25,131,296 I767V probably benign Het
Ahnak2 G A 12: 112,772,976 T748I probably damaging Het
Aoc3 T A 11: 101,331,453 L129M probably damaging Het
Arhgef7 T A 8: 11,824,667 M540K possibly damaging Het
Bod1l T A 5: 41,816,666 K2435M probably damaging Het
Col11a1 A G 3: 114,152,719 probably null Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Creb5 G T 6: 53,685,469 M250I possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dock10 A G 1: 80,566,797 I557T probably benign Het
Efcab2 G A 1: 178,437,404 A12T probably benign Het
Ehd1 A G 19: 6,294,444 N245D probably benign Het
Erich3 T A 3: 154,762,429 D839E possibly damaging Het
Fam13b T C 18: 34,487,022 T270A possibly damaging Het
Fat2 A T 11: 55,309,305 L981Q probably damaging Het
Fgfrl1 G A 5: 108,704,972 W89* probably null Het
Fgfrl1 G T 5: 108,704,973 W89C probably damaging Het
Gm10770 G A 2: 150,179,649 P11S probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Hdac3 A G 18: 37,944,933 V190A possibly damaging Het
Htr1a A G 13: 105,445,428 N392S probably damaging Het
Ift43 A G 12: 86,138,818 M59V probably benign Het
Jakmip2 T C 18: 43,565,949 T482A probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nme8 A T 13: 19,690,970 probably null Het
Olfr196 A G 16: 59,167,846 I99T probably benign Het
Peg10 CCAACAACAACAACAACAACAACA CCAACAACAACAACAACAACA 6: 4,754,276 probably benign Het
Plec A G 15: 76,173,815 F3996S probably damaging Het
Ppfia4 A T 1: 134,309,679 Y961N probably damaging Het
Rag1 G A 2: 101,644,284 P171L probably damaging Het
Rbm24 A T 13: 46,418,992 probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Rxfp3 T C 15: 11,035,870 Y472C probably damaging Het
Sh3glb2 G A 2: 30,350,619 R145W probably damaging Het
Ston2 G T 12: 91,648,096 P513T probably damaging Het
Sycp2 A G 2: 178,380,928 M470T probably damaging Het
Syt10 C A 15: 89,814,371 D257Y probably damaging Het
Tcfl5 G T 2: 180,635,262 L447I probably damaging Het
Tlr11 T C 14: 50,362,854 W766R probably benign Het
Usp33 T A 3: 152,368,487 D19E possibly damaging Het
Vmn1r123 T A 7: 21,162,943 Y253* probably null Het
Wdr55 G A 18: 36,763,124 G289D probably damaging Het
Zfp523 C T 17: 28,202,220 T235M probably damaging Het
Other mutations in Sash1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Sash1 APN 10 8751413 missense probably damaging 1.00
IGL01535:Sash1 APN 10 8741577 missense probably damaging 1.00
IGL01537:Sash1 APN 10 8729658 missense probably damaging 1.00
IGL01788:Sash1 APN 10 8733646 missense probably benign 0.01
IGL01933:Sash1 APN 10 8751133 missense probably damaging 0.99
IGL02126:Sash1 APN 10 8739465 missense probably damaging 0.96
IGL02285:Sash1 APN 10 8740334 missense probably damaging 0.99
IGL02400:Sash1 APN 10 8733647 nonsense probably null
IGL02504:Sash1 APN 10 8729912 missense probably benign 0.00
IGL02630:Sash1 APN 10 8744535 missense probably benign 0.06
R0592:Sash1 UTSW 10 8729782 missense probably benign 0.00
R0647:Sash1 UTSW 10 8729552 missense probably damaging 0.99
R0656:Sash1 UTSW 10 8751137 critical splice donor site probably null
R0830:Sash1 UTSW 10 8729909 missense probably benign 0.01
R0919:Sash1 UTSW 10 8730079 missense probably benign 0.01
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1606:Sash1 UTSW 10 8729957 missense probably benign 0.00
R1707:Sash1 UTSW 10 8730377 missense probably benign 0.00
R1922:Sash1 UTSW 10 8727908 missense possibly damaging 0.62
R1940:Sash1 UTSW 10 8729932 missense probably benign
R1964:Sash1 UTSW 10 8729713 missense probably benign 0.01
R2013:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2014:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2015:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2074:Sash1 UTSW 10 8756697 missense probably damaging 1.00
R2252:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2253:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2260:Sash1 UTSW 10 8786378 nonsense probably null
R3085:Sash1 UTSW 10 8742422 splice site probably null
R4024:Sash1 UTSW 10 8729917 missense probably benign 0.00
R4039:Sash1 UTSW 10 8729627 missense probably damaging 1.00
R4290:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4292:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4295:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4301:Sash1 UTSW 10 8751470 missense probably benign 0.00
R4657:Sash1 UTSW 10 8725660 missense probably damaging 1.00
R4669:Sash1 UTSW 10 8730385 missense probably benign 0.00
R4719:Sash1 UTSW 10 8729713 missense probably benign 0.01
R4745:Sash1 UTSW 10 8729908 missense probably benign
R5197:Sash1 UTSW 10 8740225 missense probably damaging 1.00
R5217:Sash1 UTSW 10 8780604 missense possibly damaging 0.63
R5420:Sash1 UTSW 10 8746186 missense probably damaging 1.00
R5591:Sash1 UTSW 10 8725718 missense probably benign 0.36
R6505:Sash1 UTSW 10 8729527 missense probably benign 0.21
R6761:Sash1 UTSW 10 8744522 missense probably damaging 0.99
R6885:Sash1 UTSW 10 8784221 missense probably damaging 1.00
R6980:Sash1 UTSW 10 8729848 missense probably benign 0.00
R7034:Sash1 UTSW 10 8730083 nonsense probably null
R7036:Sash1 UTSW 10 8730083 nonsense probably null
R7088:Sash1 UTSW 10 8729717 nonsense probably null
R7289:Sash1 UTSW 10 8730196 missense probably damaging 0.99
R7464:Sash1 UTSW 10 8756745 missense possibly damaging 0.82
R7661:Sash1 UTSW 10 8729391 missense probably benign 0.01
R7752:Sash1 UTSW 10 8780564 nonsense probably null
R7856:Sash1 UTSW 10 8729708 missense probably benign 0.00
R7901:Sash1 UTSW 10 8780564 nonsense probably null
R7939:Sash1 UTSW 10 8729708 missense probably benign 0.00
R7984:Sash1 UTSW 10 8780564 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCGCTATTGCCCTTAGTGAAG -3'
(R):5'- AGATCTTTGTTCCCTGGGC -3'

Sequencing Primer
(F):5'- GGGCAAGGGTAACGTTAGAATACTG -3'
(R):5'- CCACAGAAAGGAGATATCATTGAC -3'
Posted On2018-07-23