Incidental Mutation 'R6679:Ift43'
ID527395
Institutional Source Beutler Lab
Gene Symbol Ift43
Ensembl Gene ENSMUSG00000007867
Gene Nameintraflagellar transport 43
Synonyms1700019E19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6679 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location86082541-86162459 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86138818 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 59 (M59V)
Ref Sequence ENSEMBL: ENSMUSP00000152281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054565] [ENSMUST00000222821] [ENSMUST00000222905]
Predicted Effect probably benign
Transcript: ENSMUST00000054565
SMART Domains Protein: ENSMUSP00000061891
Gene: ENSMUSG00000007867

DomainStartEndE-ValueType
Pfam:IFT43 53 180 4.5e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221161
Predicted Effect probably benign
Transcript: ENSMUST00000222821
AA Change: M80V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222905
AA Change: M59V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223269
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the intraflagellar transport complex A (IFT-A). IFT-A is a multiprotein complex that plays an important role in cilia assembly and maintenance by mediating retrograde ciliary transport. Mutations in this gene are a cause of cranioectodermal dysplasia-3 (CED3), also known as Sensenbrenner syndrome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T A 5: 146,504,940 V299E probably damaging Het
Adgrb3 T C 1: 25,131,296 I767V probably benign Het
Ahnak2 G A 12: 112,772,976 T748I probably damaging Het
Aoc3 T A 11: 101,331,453 L129M probably damaging Het
Arhgef7 T A 8: 11,824,667 M540K possibly damaging Het
Bod1l T A 5: 41,816,666 K2435M probably damaging Het
Col11a1 A G 3: 114,152,719 probably null Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Creb5 G T 6: 53,685,469 M250I possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dock10 A G 1: 80,566,797 I557T probably benign Het
Efcab2 G A 1: 178,437,404 A12T probably benign Het
Ehd1 A G 19: 6,294,444 N245D probably benign Het
Erich3 T A 3: 154,762,429 D839E possibly damaging Het
Fam13b T C 18: 34,487,022 T270A possibly damaging Het
Fat2 A T 11: 55,309,305 L981Q probably damaging Het
Fgfrl1 G A 5: 108,704,972 W89* probably null Het
Fgfrl1 G T 5: 108,704,973 W89C probably damaging Het
Gm10770 G A 2: 150,179,649 P11S probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Hdac3 A G 18: 37,944,933 V190A possibly damaging Het
Htr1a A G 13: 105,445,428 N392S probably damaging Het
Jakmip2 T C 18: 43,565,949 T482A probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nme8 A T 13: 19,690,970 probably null Het
Olfr196 A G 16: 59,167,846 I99T probably benign Het
Peg10 CCAACAACAACAACAACAACAACA CCAACAACAACAACAACAACA 6: 4,754,276 probably benign Het
Plec A G 15: 76,173,815 F3996S probably damaging Het
Ppfia4 A T 1: 134,309,679 Y961N probably damaging Het
Rag1 G A 2: 101,644,284 P171L probably damaging Het
Rbm24 A T 13: 46,418,992 probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Rxfp3 T C 15: 11,035,870 Y472C probably damaging Het
Sash1 T A 10: 8,740,185 I638F probably damaging Het
Sh3glb2 G A 2: 30,350,619 R145W probably damaging Het
Ston2 G T 12: 91,648,096 P513T probably damaging Het
Sycp2 A G 2: 178,380,928 M470T probably damaging Het
Syt10 C A 15: 89,814,371 D257Y probably damaging Het
Tcfl5 G T 2: 180,635,262 L447I probably damaging Het
Tlr11 T C 14: 50,362,854 W766R probably benign Het
Usp33 T A 3: 152,368,487 D19E possibly damaging Het
Vmn1r123 T A 7: 21,162,943 Y253* probably null Het
Wdr55 G A 18: 36,763,124 G289D probably damaging Het
Zfp523 C T 17: 28,202,220 T235M probably damaging Het
Other mutations in Ift43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Ift43 APN 12 86140066 missense probably null 0.35
IGL00909:Ift43 APN 12 86162033 missense probably damaging 1.00
IGL02704:Ift43 APN 12 86161177 missense probably benign 0.00
R0383:Ift43 UTSW 12 86162021 missense possibly damaging 0.62
R0635:Ift43 UTSW 12 86085081 utr 5 prime probably benign
R5726:Ift43 UTSW 12 86162183 missense probably damaging 1.00
R7592:Ift43 UTSW 12 86161190 missense probably damaging 1.00
X0026:Ift43 UTSW 12 86161454 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGGACACACAGACACATATGC -3'
(R):5'- AGATTCCAGGCCATCTGATTTT -3'

Sequencing Primer
(F):5'- GCACACATATGCATGCTAAGG -3'
(R):5'- GGTCAGTTCAAGCCTCTAGAACTG -3'
Posted On2018-07-23