Incidental Mutation 'R6679:Syt10'
ID527404
Institutional Source Beutler Lab
Gene Symbol Syt10
Ensembl Gene ENSMUSG00000063260
Gene Namesynaptotagmin X
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6679 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location89782393-89841860 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 89814371 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 257 (D257Y)
Ref Sequence ENSEMBL: ENSMUSP00000029441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029441]
Predicted Effect probably damaging
Transcript: ENSMUST00000029441
AA Change: D257Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029441
Gene: ENSMUSG00000063260
AA Change: D257Y

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
C2 247 350 1.22e-19 SMART
C2 379 493 7.73e-22 SMART
Meta Mutation Damage Score 0.3464 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 91% (40/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-in allele exhibit minor circadian rhythm impairments. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T A 5: 146,504,940 V299E probably damaging Het
Adgrb3 T C 1: 25,131,296 I767V probably benign Het
Ahnak2 G A 12: 112,772,976 T748I probably damaging Het
Aoc3 T A 11: 101,331,453 L129M probably damaging Het
Arhgef7 T A 8: 11,824,667 M540K possibly damaging Het
Bod1l T A 5: 41,816,666 K2435M probably damaging Het
Col11a1 A G 3: 114,152,719 probably null Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Creb5 G T 6: 53,685,469 M250I possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dock10 A G 1: 80,566,797 I557T probably benign Het
Efcab2 G A 1: 178,437,404 A12T probably benign Het
Ehd1 A G 19: 6,294,444 N245D probably benign Het
Erich3 T A 3: 154,762,429 D839E possibly damaging Het
Fam13b T C 18: 34,487,022 T270A possibly damaging Het
Fat2 A T 11: 55,309,305 L981Q probably damaging Het
Fgfrl1 G A 5: 108,704,972 W89* probably null Het
Fgfrl1 G T 5: 108,704,973 W89C probably damaging Het
Gm10770 G A 2: 150,179,649 P11S probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Hdac3 A G 18: 37,944,933 V190A possibly damaging Het
Htr1a A G 13: 105,445,428 N392S probably damaging Het
Ift43 A G 12: 86,138,818 M59V probably benign Het
Jakmip2 T C 18: 43,565,949 T482A probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nme8 A T 13: 19,690,970 probably null Het
Olfr196 A G 16: 59,167,846 I99T probably benign Het
Peg10 CCAACAACAACAACAACAACAACA CCAACAACAACAACAACAACA 6: 4,754,276 probably benign Het
Plec A G 15: 76,173,815 F3996S probably damaging Het
Ppfia4 A T 1: 134,309,679 Y961N probably damaging Het
Rag1 G A 2: 101,644,284 P171L probably damaging Het
Rbm24 A T 13: 46,418,992 probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Rxfp3 T C 15: 11,035,870 Y472C probably damaging Het
Sash1 T A 10: 8,740,185 I638F probably damaging Het
Sh3glb2 G A 2: 30,350,619 R145W probably damaging Het
Ston2 G T 12: 91,648,096 P513T probably damaging Het
Sycp2 A G 2: 178,380,928 M470T probably damaging Het
Tcfl5 G T 2: 180,635,262 L447I probably damaging Het
Tlr11 T C 14: 50,362,854 W766R probably benign Het
Usp33 T A 3: 152,368,487 D19E possibly damaging Het
Vmn1r123 T A 7: 21,162,943 Y253* probably null Het
Wdr55 G A 18: 36,763,124 G289D probably damaging Het
Zfp523 C T 17: 28,202,220 T235M probably damaging Het
Other mutations in Syt10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02718:Syt10 APN 15 89814079 missense probably damaging 1.00
IGL02976:Syt10 APN 15 89814479 missense probably benign 0.26
R0200:Syt10 UTSW 15 89826941 missense probably benign 0.01
R0306:Syt10 UTSW 15 89826988 missense probably benign 0.02
R0580:Syt10 UTSW 15 89827176 missense probably benign 0.15
R0608:Syt10 UTSW 15 89826941 missense probably benign 0.01
R1705:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R1706:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R1921:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R1922:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2072:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2074:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2119:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2120:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2121:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R3812:Syt10 UTSW 15 89790797 missense probably benign
R4029:Syt10 UTSW 15 89814538 missense probably benign
R4270:Syt10 UTSW 15 89790892 missense probably benign 0.39
R4536:Syt10 UTSW 15 89782622 missense probably damaging 0.99
R5333:Syt10 UTSW 15 89841729 missense probably benign 0.00
R6042:Syt10 UTSW 15 89841621 missense probably benign 0.13
R6104:Syt10 UTSW 15 89826864 missense probably benign 0.02
R6445:Syt10 UTSW 15 89814268 missense probably damaging 1.00
R6470:Syt10 UTSW 15 89792601 missense probably damaging 1.00
R6472:Syt10 UTSW 15 89814558 missense probably benign
R7048:Syt10 UTSW 15 89790805 missense probably damaging 1.00
R7128:Syt10 UTSW 15 89814111 missense probably damaging 1.00
R7315:Syt10 UTSW 15 89814338 missense probably damaging 0.99
R7352:Syt10 UTSW 15 89814456 missense probably benign 0.42
R7686:Syt10 UTSW 15 89814157 missense probably damaging 1.00
R7789:Syt10 UTSW 15 89826898 missense probably damaging 1.00
R7937:Syt10 UTSW 15 89782617 missense probably damaging 1.00
X0057:Syt10 UTSW 15 89826928 missense probably damaging 1.00
Z1088:Syt10 UTSW 15 89841639 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATACTAAAGTGTAGTTTGCGGTTGC -3'
(R):5'- TGAATGTCTCCAGCGTCGAC -3'

Sequencing Primer
(F):5'- GGTTGCTTAGCTGATCGTAAACCAC -3'
(R):5'- ACTTTAGCGTGGGCACTGAAC -3'
Posted On2018-07-23