Incidental Mutation 'R6588:Itfg1'
ID527420
Institutional Source Beutler Lab
Gene Symbol Itfg1
Ensembl Gene ENSMUSG00000031703
Gene Nameintegrin alpha FG-GAP repeat containing 1
SynonymsD8Wsu49e, 2310047C21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R6588 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location85717578-85840921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85736130 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 455 (I455V)
Ref Sequence ENSEMBL: ENSMUSP00000034140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034140]
Predicted Effect probably benign
Transcript: ENSMUST00000034140
AA Change: I455V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034140
Gene: ENSMUSG00000031703
AA Change: I455V

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
SCOP:d1m1xa4 46 232 5e-3 SMART
low complexity region 482 496 N/A INTRINSIC
transmembrane domain 564 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210912
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,192,647 S132P probably benign Het
Bean1 CT C 8: 104,182,032 probably null Homo
Clcn3 T C 8: 60,914,827 I763V probably benign Het
Cpsf1 A G 15: 76,596,822 Y1254H probably damaging Het
Erc1 C T 6: 119,575,726 A1088T possibly damaging Het
Fhl4 A G 10: 85,098,107 V270A possibly damaging Het
Ghr T C 15: 3,320,268 E476G probably benign Het
H2afy C T 13: 56,104,489 G97D possibly damaging Het
Ighv1-84 T A 12: 115,980,751 Q101L probably benign Het
Kitl T A 10: 100,064,092 N86K probably damaging Het
Kmt2c C T 5: 25,323,789 G1614E probably damaging Het
Lrrd1 A G 5: 3,851,386 S564G probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Mms19 C T 19: 41,966,276 R68Q probably damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr433 G T 1: 174,042,278 M109I probably benign Het
Olfr866 G T 9: 20,027,866 P24Q probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Zfp64 A T 2: 168,926,907 C262S probably damaging Het
Other mutations in Itfg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02579:Itfg1 APN 8 85780565 missense possibly damaging 0.95
IGL02803:Itfg1 APN 8 85725511 splice site probably null
R0368:Itfg1 UTSW 8 85764407 missense probably damaging 1.00
R0755:Itfg1 UTSW 8 85726205 missense possibly damaging 0.90
R1183:Itfg1 UTSW 8 85780523 missense probably benign 0.04
R1529:Itfg1 UTSW 8 85810614 missense probably benign 0.02
R1789:Itfg1 UTSW 8 85725512 critical splice donor site probably null
R1953:Itfg1 UTSW 8 85831231 missense probably benign 0.31
R2206:Itfg1 UTSW 8 85776198 missense probably benign 0.17
R2207:Itfg1 UTSW 8 85776198 missense probably benign 0.17
R2260:Itfg1 UTSW 8 85722677 missense probably damaging 1.00
R2358:Itfg1 UTSW 8 85738129 missense probably damaging 1.00
R2876:Itfg1 UTSW 8 85780510 splice site probably benign
R2990:Itfg1 UTSW 8 85835049 missense possibly damaging 0.82
R4484:Itfg1 UTSW 8 85726249 missense probably damaging 1.00
R4762:Itfg1 UTSW 8 85732441 missense possibly damaging 0.95
R5146:Itfg1 UTSW 8 85718868 makesense probably null
R5796:Itfg1 UTSW 8 85718893 missense probably damaging 1.00
R5805:Itfg1 UTSW 8 85766972 missense probably benign 0.04
R6084:Itfg1 UTSW 8 85726170 missense probably benign 0.01
R6187:Itfg1 UTSW 8 85836465 missense probably damaging 1.00
R6319:Itfg1 UTSW 8 85840629 missense probably damaging 1.00
R6463:Itfg1 UTSW 8 85736151 missense probably benign 0.03
R6490:Itfg1 UTSW 8 85740301 missense probably benign 0.08
R6492:Itfg1 UTSW 8 85740349 missense probably benign 0.14
R6753:Itfg1 UTSW 8 85835078 missense probably benign 0.04
R7489:Itfg1 UTSW 8 85767001 missense probably damaging 1.00
R7665:Itfg1 UTSW 8 85764350 missense probably benign
R7912:Itfg1 UTSW 8 85764280 missense probably damaging 1.00
R7985:Itfg1 UTSW 8 85725568 missense probably damaging 1.00
X0067:Itfg1 UTSW 8 85840753 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTAGCAATTTCCTTGAGTAAGACAG -3'
(R):5'- ATTGGAGATCATGAGTCAGTGGATG -3'

Sequencing Primer
(F):5'- GCACCATGTGTATACAGTTCCTGAG -3'
(R):5'- GCAGGGAGAGATAGATCTT -3'
Posted On2018-07-23