Incidental Mutation 'R6588:2210408I21Rik'
ID527428
Institutional Source Beutler Lab
Gene Symbol 2210408I21Rik
Ensembl Gene ENSMUSG00000071252
Gene NameRIKEN cDNA 2210408I21 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6588 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location77135540-77613784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77192647 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 132 (S132P)
Ref Sequence ENSEMBL: ENSMUSP00000153096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168779] [ENSMUST00000225605] [ENSMUST00000225760]
Predicted Effect probably benign
Transcript: ENSMUST00000168779
AA Change: S132P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127449
Gene: ENSMUSG00000071252
AA Change: S132P

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
Pfam:DUF4495 515 832 1.6e-140 PFAM
low complexity region 1241 1255 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225605
AA Change: S132P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225760
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bean1 CT C 8: 104,182,032 probably null Homo
Clcn3 T C 8: 60,914,827 I763V probably benign Het
Cpsf1 A G 15: 76,596,822 Y1254H probably damaging Het
Erc1 C T 6: 119,575,726 A1088T possibly damaging Het
Fhl4 A G 10: 85,098,107 V270A possibly damaging Het
Ghr T C 15: 3,320,268 E476G probably benign Het
H2afy C T 13: 56,104,489 G97D possibly damaging Het
Ighv1-84 T A 12: 115,980,751 Q101L probably benign Het
Itfg1 T C 8: 85,736,130 I455V probably benign Het
Kitl T A 10: 100,064,092 N86K probably damaging Het
Kmt2c C T 5: 25,323,789 G1614E probably damaging Het
Lrrd1 A G 5: 3,851,386 S564G probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Mms19 C T 19: 41,966,276 R68Q probably damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr433 G T 1: 174,042,278 M109I probably benign Het
Olfr866 G T 9: 20,027,866 P24Q probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Zfp64 A T 2: 168,926,907 C262S probably damaging Het
Other mutations in 2210408I21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:2210408I21Rik APN 13 77323358 splice site probably benign
IGL01154:2210408I21Rik APN 13 77281094 missense probably benign 0.01
IGL01461:2210408I21Rik APN 13 77281095 missense probably benign 0.25
IGL01624:2210408I21Rik APN 13 77193086 missense probably damaging 0.99
IGL02033:2210408I21Rik APN 13 77259876 missense possibly damaging 0.90
IGL02621:2210408I21Rik APN 13 77260031 missense possibly damaging 0.92
IGL02718:2210408I21Rik APN 13 77174872 missense probably damaging 1.00
IGL02823:2210408I21Rik APN 13 77261955 missense probably damaging 0.96
IGL02859:2210408I21Rik APN 13 77267699 missense possibly damaging 0.71
IGL03006:2210408I21Rik APN 13 77323772 critical splice donor site probably null
IGL03072:2210408I21Rik APN 13 77259997 missense probably benign
IGL03184:2210408I21Rik APN 13 77323451 missense possibly damaging 0.63
IGL03275:2210408I21Rik APN 13 77298555 missense possibly damaging 0.71
PIT4651001:2210408I21Rik UTSW 13 77259895 missense probably benign
R0226:2210408I21Rik UTSW 13 77303425 missense possibly damaging 0.86
R0323:2210408I21Rik UTSW 13 77298555 missense possibly damaging 0.71
R0614:2210408I21Rik UTSW 13 77192663 missense probably benign 0.26
R0894:2210408I21Rik UTSW 13 77323607 missense probably benign 0.18
R1165:2210408I21Rik UTSW 13 77334287 missense probably benign 0.06
R1509:2210408I21Rik UTSW 13 77192647 missense probably benign
R1711:2210408I21Rik UTSW 13 77269920 missense possibly damaging 0.93
R1714:2210408I21Rik UTSW 13 77316360 missense possibly damaging 0.86
R1718:2210408I21Rik UTSW 13 77245370 intron probably benign
R1836:2210408I21Rik UTSW 13 77323374 missense probably benign 0.00
R1893:2210408I21Rik UTSW 13 77267809 missense possibly damaging 0.93
R2035:2210408I21Rik UTSW 13 77612642 makesense probably null
R2329:2210408I21Rik UTSW 13 77303325 missense probably benign 0.04
R2897:2210408I21Rik UTSW 13 77323521 missense probably benign 0.33
R3688:2210408I21Rik UTSW 13 77267849 missense possibly damaging 0.52
R4153:2210408I21Rik UTSW 13 77193173 missense probably benign 0.00
R4387:2210408I21Rik UTSW 13 77316574 critical splice donor site probably null
R4388:2210408I21Rik UTSW 13 77316574 critical splice donor site probably null
R4499:2210408I21Rik UTSW 13 77316527 missense possibly damaging 0.96
R4614:2210408I21Rik UTSW 13 77254256 intron probably null
R4798:2210408I21Rik UTSW 13 77323724 missense possibly damaging 0.96
R4943:2210408I21Rik UTSW 13 77245327 missense possibly damaging 0.86
R5045:2210408I21Rik UTSW 13 77267808 synonymous probably null
R5387:2210408I21Rik UTSW 13 77259973 missense probably benign 0.11
R5500:2210408I21Rik UTSW 13 77303389 missense probably benign 0.33
R5686:2210408I21Rik UTSW 13 77303314 missense possibly damaging 0.72
R6111:2210408I21Rik UTSW 13 77327902 missense possibly damaging 0.72
R6135:2210408I21Rik UTSW 13 77254216 missense probably damaging 0.98
R6188:2210408I21Rik UTSW 13 77183731 missense possibly damaging 0.53
R6388:2210408I21Rik UTSW 13 77262111 missense probably benign
R6632:2210408I21Rik UTSW 13 77281067 missense possibly damaging 0.86
R6638:2210408I21Rik UTSW 13 77303402 missense probably benign 0.07
R6755:2210408I21Rik UTSW 13 77327875 missense probably benign
R6971:2210408I21Rik UTSW 13 77193187 missense possibly damaging 0.90
R7079:2210408I21Rik UTSW 13 77254204 missense possibly damaging 0.86
R7130:2210408I21Rik UTSW 13 77269902 missense possibly damaging 0.93
R7215:2210408I21Rik UTSW 13 77323571 missense possibly damaging 0.96
R7272:2210408I21Rik UTSW 13 77323536 missense probably benign 0.00
R7331:2210408I21Rik UTSW 13 77183609 missense possibly damaging 0.53
R7561:2210408I21Rik UTSW 13 77193195 missense probably benign
R7684:2210408I21Rik UTSW 13 77612540 nonsense probably null
R7728:2210408I21Rik UTSW 13 77316477 missense possibly damaging 0.96
R7881:2210408I21Rik UTSW 13 77323566 missense possibly damaging 0.53
R7964:2210408I21Rik UTSW 13 77323566 missense possibly damaging 0.53
R8008:2210408I21Rik UTSW 13 77281115 missense probably benign 0.28
R8024:2210408I21Rik UTSW 13 77612594 missense probably benign
X0066:2210408I21Rik UTSW 13 77183640 missense possibly damaging 0.72
Z1088:2210408I21Rik UTSW 13 77174891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTCTCGAGGCGTATAGG -3'
(R):5'- CTTCTGATTCTGAGTAGAGCAAGAG -3'

Sequencing Primer
(F):5'- CTCGAGGCGTATAGGATATTCATTC -3'
(R):5'- CAAGAGGAATTGCTTCATACATTGAC -3'
Posted On2018-07-23