Incidental Mutation 'R6588:Olfr107'
ID527431
Institutional Source Beutler Lab
Gene Symbol Olfr107
Ensembl Gene ENSMUSG00000063188
Gene Nameolfactory receptor 107
SynonymsMOR156-3, GA_x6K02T2PSCP-1867165-1868094
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R6588 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location37399226-37407477 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37405905 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 119 (R119H)
Ref Sequence ENSEMBL: ENSMUSP00000148879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077008] [ENSMUST00000215894] [ENSMUST00000215947] [ENSMUST00000215974] [ENSMUST00000216844]
Predicted Effect probably benign
Transcript: ENSMUST00000077008
AA Change: R119H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000076267
Gene: ENSMUSG00000063188
AA Change: R119H

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.3e-54 PFAM
Pfam:7TM_GPCR_Srsx 32 302 1.3e-5 PFAM
Pfam:7tm_1 38 287 3.7e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174238
Predicted Effect probably benign
Transcript: ENSMUST00000215894
AA Change: R119H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000215947
AA Change: R119H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000215974
AA Change: R119H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000216844
AA Change: R119H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,192,647 S132P probably benign Het
Bean1 CT C 8: 104,182,032 probably null Homo
Clcn3 T C 8: 60,914,827 I763V probably benign Het
Cpsf1 A G 15: 76,596,822 Y1254H probably damaging Het
Erc1 C T 6: 119,575,726 A1088T possibly damaging Het
Fhl4 A G 10: 85,098,107 V270A possibly damaging Het
Ghr T C 15: 3,320,268 E476G probably benign Het
H2afy C T 13: 56,104,489 G97D possibly damaging Het
Ighv1-84 T A 12: 115,980,751 Q101L probably benign Het
Itfg1 T C 8: 85,736,130 I455V probably benign Het
Kitl T A 10: 100,064,092 N86K probably damaging Het
Kmt2c C T 5: 25,323,789 G1614E probably damaging Het
Lrrd1 A G 5: 3,851,386 S564G probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Mms19 C T 19: 41,966,276 R68Q probably damaging Het
Olfr433 G T 1: 174,042,278 M109I probably benign Het
Olfr866 G T 9: 20,027,866 P24Q probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Zfp64 A T 2: 168,926,907 C262S probably damaging Het
Other mutations in Olfr107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Olfr107 APN 17 37406140 missense probably benign 0.00
IGL01614:Olfr107 APN 17 37405638 missense probably benign 0.00
IGL02390:Olfr107 APN 17 37406095 missense probably benign 0.04
R1051:Olfr107 UTSW 17 37406450 missense possibly damaging 0.74
R4767:Olfr107 UTSW 17 37406200 nonsense probably null
R4849:Olfr107 UTSW 17 37405698 missense probably benign 0.16
R6182:Olfr107 UTSW 17 37405992 missense possibly damaging 0.65
R6550:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6551:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6552:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6555:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6584:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6586:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6688:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6758:Olfr107 UTSW 17 37405695 missense probably damaging 0.97
R7024:Olfr107 UTSW 17 37406204 missense probably benign 0.04
R7083:Olfr107 UTSW 17 37406172 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTCAGTCAGCTCTCACTAGTG -3'
(R):5'- CACTGAGGTGAGTGTCTGAG -3'

Sequencing Primer
(F):5'- AGTCAGCTCTCACTAGTGGATCTTTG -3'
(R):5'- CAGTAAGAGAGGCCTAGAATCAC -3'
Posted On2018-07-23