Incidental Mutation 'R6740:Efcab8'
ID527434
Institutional Source Beutler Lab
Gene Symbol Efcab8
Ensembl Gene ENSMUSG00000044083
Gene NameEF-hand calcium binding domain 8
SynonymsEG329541
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6740 (G1) of strain 613
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location153779931-153844751 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 153804894 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 381 (H381R)
Ref Sequence ENSEMBL: ENSMUSP00000135661 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000126656
AA Change: H381R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 8 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610044O15Rik8 A C 8: 129,234,400 probably null Het
Cyp2e1 C T 7: 140,763,780 probably benign Het
Eea1 C G 10: 96,023,993 H714D probably benign Het
Fer1l4 A G 2: 156,031,222 S1313P probably damaging Het
Itih3 T C 14: 30,912,687 N121S probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrch1 A G 14: 74,811,623 S395P probably benign Het
Rnf180 G A 13: 105,181,506 A466V possibly damaging Het
Other mutations in Efcab8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1709:Efcab8 UTSW 2 153814370 splice site probably null
R2324:Efcab8 UTSW 2 153783809 splice site probably null
R4002:Efcab8 UTSW 2 153781806 missense probably benign 0.20
R5208:Efcab8 UTSW 2 153802423 nonsense probably null
R5393:Efcab8 UTSW 2 153780983 missense unknown
R5411:Efcab8 UTSW 2 153783756 missense probably damaging 0.96
R5766:Efcab8 UTSW 2 153780992 missense possibly damaging 0.90
R6255:Efcab8 UTSW 2 153810268 missense possibly damaging 0.87
R6266:Efcab8 UTSW 2 153783768 missense probably damaging 1.00
R6714:Efcab8 UTSW 2 153789210 missense probably damaging 0.99
R7706:Efcab8 UTSW 2 153781775 missense
R7719:Efcab8 UTSW 2 153787745 missense
R7765:Efcab8 UTSW 2 153843190 missense
R7822:Efcab8 UTSW 2 153810912 missense unknown
R8207:Efcab8 UTSW 2 153789225 missense not run
Z1177:Efcab8 UTSW 2 153798680 missense probably null
Predicted Primers PCR Primer
(F):5'- TTTCTGAGACAGGGATGGGC -3'
(R):5'- ATCTGTTTAAGGCTTGCCTGC -3'

Sequencing Primer
(F):5'- AGACACTTTGGCCATGAGACCTG -3'
(R):5'- GCTTGCCTGCCACCTGC -3'
Posted On2018-07-23