Incidental Mutation 'R6740:Itih3'
ID527440
Institutional Source Beutler Lab
Gene Symbol Itih3
Ensembl Gene ENSMUSG00000006522
Gene Nameinter-alpha trypsin inhibitor, heavy chain 3
SynonymsItih-3, Intin3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6740 (G1) of strain 613
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location30908572-30923760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30912687 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 121 (N121S)
Ref Sequence ENSEMBL: ENSMUSP00000154256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006697] [ENSMUST00000226547] [ENSMUST00000227995] [ENSMUST00000228114]
Predicted Effect probably benign
Transcript: ENSMUST00000006697
AA Change: N660S

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000006697
Gene: ENSMUSG00000006522
AA Change: N660S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VIT 29 158 3.87e-83 SMART
VWA 282 466 1.19e-29 SMART
Blast:VWA 571 634 2e-21 BLAST
Pfam:ITI_HC_C 683 870 3e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112141
Predicted Effect probably benign
Transcript: ENSMUST00000166622
AA Change: N121S

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131805
Gene: ENSMUSG00000006522
AA Change: N121S

DomainStartEndE-ValueType
Blast:VWA 17 80 1e-23 BLAST
Pfam:ITI_HC_C 143 224 3.9e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226179
Predicted Effect probably benign
Transcript: ENSMUST00000226547
AA Change: N121S

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227181
Predicted Effect probably benign
Transcript: ENSMUST00000227995
Predicted Effect probably benign
Transcript: ENSMUST00000228114
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes one of the heavy subunits of inter alpha trypsin inhibitor that functions as a protease inhibitor circulating in the plasma. The encoded protein undergoes proteolytic processing to generate a mature glycoprotein that is linked to the other subunits via an ester bond between the C-terminal aspartic acid residue and the N-acetyl galactosamine residue of chondroitin sulfate. This gene is located in a cluster of related inter alpha trypsin inhibitor genes on chromosome 14. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 8 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610044O15Rik8 A C 8: 129,234,400 probably null Het
Cyp2e1 C T 7: 140,763,780 probably benign Het
Eea1 C G 10: 96,023,993 H714D probably benign Het
Efcab8 A G 2: 153,804,894 H381R probably damaging Het
Fer1l4 A G 2: 156,031,222 S1313P probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrch1 A G 14: 74,811,623 S395P probably benign Het
Rnf180 G A 13: 105,181,506 A466V possibly damaging Het
Other mutations in Itih3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Itih3 APN 14 30909781 missense probably damaging 0.98
IGL01359:Itih3 APN 14 30917772 missense probably damaging 1.00
IGL01965:Itih3 APN 14 30915720 missense probably damaging 0.99
IGL02435:Itih3 APN 14 30915754 missense probably damaging 0.99
IGL02539:Itih3 APN 14 30912664 missense probably benign 0.03
IGL02637:Itih3 APN 14 30915660 missense probably benign 0.00
IGL02958:Itih3 APN 14 30913182 missense probably benign 0.00
IGL03253:Itih3 APN 14 30911923 critical splice donor site probably null
K2124:Itih3 UTSW 14 30912687 missense probably benign 0.40
R0321:Itih3 UTSW 14 30912106 missense probably damaging 0.99
R0466:Itih3 UTSW 14 30912874 critical splice donor site probably null
R1402:Itih3 UTSW 14 30908708 missense probably damaging 1.00
R1402:Itih3 UTSW 14 30908708 missense probably damaging 1.00
R1633:Itih3 UTSW 14 30917398 missense possibly damaging 0.46
R1982:Itih3 UTSW 14 30923583 unclassified probably benign
R2056:Itih3 UTSW 14 30909524 splice site probably null
R2077:Itih3 UTSW 14 30909835 missense possibly damaging 0.91
R2417:Itih3 UTSW 14 30917664 missense probably benign 0.04
R3624:Itih3 UTSW 14 30914743 missense probably damaging 1.00
R3794:Itih3 UTSW 14 30918394 missense probably damaging 1.00
R4676:Itih3 UTSW 14 30918949 missense probably null 1.00
R4676:Itih3 UTSW 14 30921686 missense possibly damaging 0.91
R5198:Itih3 UTSW 14 30912649 missense probably benign 0.07
R5429:Itih3 UTSW 14 30923521 missense probably benign 0.00
R6379:Itih3 UTSW 14 30909724 missense probably damaging 1.00
R6752:Itih3 UTSW 14 30923489 missense possibly damaging 0.76
R6765:Itih3 UTSW 14 30909473 missense probably benign
R6785:Itih3 UTSW 14 30912615 critical splice donor site probably null
R6871:Itih3 UTSW 14 30912687 missense probably benign 0.40
R6935:Itih3 UTSW 14 30912702 missense possibly damaging 0.82
R7133:Itih3 UTSW 14 30917698 missense probably damaging 1.00
R7419:Itih3 UTSW 14 30914773 missense probably benign 0.41
R7592:Itih3 UTSW 14 30908765 missense probably damaging 0.98
R7598:Itih3 UTSW 14 30917377 missense possibly damaging 0.95
R7662:Itih3 UTSW 14 30917330 missense probably benign 0.00
R8183:Itih3 UTSW 14 30909476 missense probably benign
Y5408:Itih3 UTSW 14 30921945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTTGTGCAGAGTGTTC -3'
(R):5'- GCCCCTACTATTATGGTGAGTTG -3'

Sequencing Primer
(F):5'- CCCTTGTGCAGAGTGTTCTATAAG -3'
(R):5'- GTGAGTTGCTTGGCTCCTCC -3'
Posted On2018-07-23