Incidental Mutation 'R6740:Lrch1'
ID527441
Institutional Source Beutler Lab
Gene Symbol Lrch1
Ensembl Gene ENSMUSG00000068015
Gene Nameleucine-rich repeats and calponin homology (CH) domain containing 1
Synonyms4832412D13Rik, Chdc1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6740 (G1) of strain 613
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location74754675-74947876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74811623 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 395 (S395P)
Ref Sequence ENSEMBL: ENSMUSP00000154004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088970] [ENSMUST00000228252]
Predicted Effect probably benign
Transcript: ENSMUST00000088970
AA Change: S395P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086363
Gene: ENSMUSG00000068015
AA Change: S395P

DomainStartEndE-ValueType
low complexity region 25 44 N/A INTRINSIC
LRR 109 131 1.86e1 SMART
LRR_TYP 132 155 3.39e-3 SMART
LRR 177 199 1.41e1 SMART
LRR 200 223 4.34e-1 SMART
LRR 245 268 1.66e1 SMART
low complexity region 306 322 N/A INTRINSIC
CH 591 698 1.71e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228134
Predicted Effect probably benign
Transcript: ENSMUST00000228252
AA Change: S395P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0972 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a leucine-rich repeat and a calponin homology domain. Polymorphism in this gene may be associated with susceptibililty to knee osteoarthritis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous knockout leads to increased susceptibility to experimental autoimmune encephalomyelitis as a result of increased migration of T cells into the central nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 8 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610044O15Rik8 A C 8: 129,234,400 probably null Het
Cyp2e1 C T 7: 140,763,780 probably benign Het
Eea1 C G 10: 96,023,993 H714D probably benign Het
Efcab8 A G 2: 153,804,894 H381R probably damaging Het
Fer1l4 A G 2: 156,031,222 S1313P probably damaging Het
Itih3 T C 14: 30,912,687 N121S probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Rnf180 G A 13: 105,181,506 A466V possibly damaging Het
Other mutations in Lrch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Lrch1 APN 14 74757063 missense probably benign 0.22
IGL01137:Lrch1 APN 14 74757092 missense probably damaging 0.98
IGL01978:Lrch1 APN 14 74786342 missense probably damaging 1.00
IGL01988:Lrch1 APN 14 74795373 splice site probably benign
IGL02036:Lrch1 APN 14 74795293 splice site probably benign
IGL02650:Lrch1 APN 14 74813698 missense probably damaging 1.00
IGL03006:Lrch1 APN 14 74813620 missense probably damaging 0.99
IGL03106:Lrch1 APN 14 74835762 missense possibly damaging 0.84
IGL03353:Lrch1 APN 14 74858042 missense probably damaging 1.00
FR4304:Lrch1 UTSW 14 74819565 missense possibly damaging 0.81
LCD18:Lrch1 UTSW 14 74905021 intron probably benign
R0129:Lrch1 UTSW 14 74835746 missense probably benign 0.13
R0312:Lrch1 UTSW 14 74947594 missense possibly damaging 0.82
R0441:Lrch1 UTSW 14 74947545 missense possibly damaging 0.95
R0622:Lrch1 UTSW 14 74796051 missense probably benign 0.00
R1418:Lrch1 UTSW 14 74804269 splice site probably benign
R1618:Lrch1 UTSW 14 74813704 missense probably damaging 1.00
R2116:Lrch1 UTSW 14 74785531 missense probably damaging 1.00
R2428:Lrch1 UTSW 14 74807545 splice site probably benign
R3707:Lrch1 UTSW 14 74857997 missense probably damaging 0.99
R4352:Lrch1 UTSW 14 74818578 missense probably damaging 0.98
R5689:Lrch1 UTSW 14 74786324 missense probably damaging 1.00
R5754:Lrch1 UTSW 14 74817118 missense probably damaging 1.00
R6142:Lrch1 UTSW 14 74947500 missense probably damaging 1.00
R6469:Lrch1 UTSW 14 74817085 missense probably damaging 1.00
R6871:Lrch1 UTSW 14 74811623 missense probably benign
R7051:Lrch1 UTSW 14 74785522 missense probably damaging 1.00
R7438:Lrch1 UTSW 14 74757037 missense possibly damaging 0.88
R7509:Lrch1 UTSW 14 74947608 missense probably benign 0.25
R8037:Lrch1 UTSW 14 74786354 missense probably damaging 1.00
R8262:Lrch1 UTSW 14 74818495 missense probably damaging 0.97
RF002:Lrch1 UTSW 14 74947574 small deletion probably benign
RF009:Lrch1 UTSW 14 74947574 small deletion probably benign
RF018:Lrch1 UTSW 14 74947555 frame shift probably null
RF022:Lrch1 UTSW 14 74947574 small deletion probably benign
RF023:Lrch1 UTSW 14 74947566 frame shift probably null
RF037:Lrch1 UTSW 14 74947549 small deletion probably benign
RF039:Lrch1 UTSW 14 74947549 small deletion probably benign
RF043:Lrch1 UTSW 14 74947575 frame shift probably null
RF061:Lrch1 UTSW 14 74947555 frame shift probably null
RF061:Lrch1 UTSW 14 74947567 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCCTCAAGCTTAGAGAGGAG -3'
(R):5'- CCCCTTTACATTCTGCAGAGG -3'

Sequencing Primer
(F):5'- CCTCAAGCTTAGAGAGGAGATGCTG -3'
(R):5'- GGCAATAAATCATGGGTTGCTC -3'
Posted On2018-07-23