Incidental Mutation 'R6680:Zscan4d'
ID527449
Institutional Source Beutler Lab
Gene Symbol Zscan4d
Ensembl Gene ENSMUSG00000090714
Gene Namezinc finger and SCAN domain containing 4D
SynonymsEG545913
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R6680 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location11161374-11166159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11162439 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 335 (S335T)
Ref Sequence ENSEMBL: ENSMUSP00000066504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067210]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067210
AA Change: S335T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066504
Gene: ENSMUSG00000090714
AA Change: S335T

DomainStartEndE-ValueType
Pfam:SCAN 39 126 2.5e-19 PFAM
low complexity region 181 197 N/A INTRINSIC
ZnF_C2H2 395 417 5.14e-3 SMART
ZnF_C2H2 424 446 7.68e0 SMART
ZnF_C2H2 452 474 4.17e-3 SMART
ZnF_C2H2 480 503 3.83e-2 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A G 9: 105,143,574 S163P probably damaging Het
Adgre4 A G 17: 55,791,959 K155R probably benign Het
Ankrd31 T A 13: 96,830,609 probably null Het
AW011738 A G 4: 156,203,725 probably benign Het
Ccl3 A G 11: 83,648,306 S76P probably benign Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Fat2 G T 11: 55,310,858 Y463* probably null Het
Frem3 A G 8: 80,669,320 T1915A probably damaging Het
Gm36028 T C 16: 37,856,174 D77G probably benign Het
Hspg2 A G 4: 137,565,737 Q4162R probably benign Het
Krt87 C T 15: 101,433,978 R293H probably damaging Het
Mipep A G 14: 60,788,223 I143V possibly damaging Het
Mrc2 C T 11: 105,325,753 R123C probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Ndc80 T C 17: 71,517,545 K223R probably null Het
Nuf2 A C 1: 169,515,009 probably null Het
Olfr1055 T A 2: 86,347,245 I174F probably damaging Het
Olfr33 T A 7: 102,714,315 I33F possibly damaging Het
Olfr935 T C 9: 38,994,658 Y259C probably damaging Het
Omd T C 13: 49,589,528 V18A possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Shank2 A G 7: 144,420,866 S1384G probably damaging Het
Slc22a28 A G 19: 8,101,393 S311P probably benign Het
Sox6 C T 7: 115,476,983 E765K possibly damaging Het
Tas2r106 A T 6: 131,678,474 I138K probably damaging Het
Tbx15 T A 3: 99,313,073 Y54* probably null Het
Tulp4 T G 17: 6,139,037 W45G probably damaging Het
Ugt3a2 T C 15: 9,370,068 Y433H probably damaging Het
Usp13 T C 3: 32,881,469 V348A probably damaging Het
Vezf1 T C 11: 88,081,584 I439T probably benign Het
Vmn2r93 C A 17: 18,316,658 Y534* probably null Het
Wdr92 T C 11: 17,229,857 L286P probably damaging Het
Zfp579 A G 7: 4,993,502 L470P probably damaging Het
Zfp598 A G 17: 24,678,686 N327S probably benign Het
Other mutations in Zscan4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Zscan4d APN 7 11162354 missense probably benign 0.00
IGL01576:Zscan4d APN 7 11162592 missense possibly damaging 0.91
IGL01926:Zscan4d APN 7 11164994 missense probably damaging 0.98
IGL02008:Zscan4d APN 7 11162369 missense probably benign 0.00
IGL02245:Zscan4d APN 7 11162789 missense probably benign
IGL02473:Zscan4d APN 7 11162409 missense probably benign 0.04
IGL02805:Zscan4d APN 7 11164970 splice site probably benign
IGL03010:Zscan4d APN 7 11163143 missense probably damaging 0.98
IGL03383:Zscan4d APN 7 11162765 missense probably benign 0.07
R0626:Zscan4d UTSW 7 11165019 missense probably damaging 0.97
R1084:Zscan4d UTSW 7 11165005 missense probably damaging 0.99
R1457:Zscan4d UTSW 7 11164994 missense probably damaging 0.98
R2426:Zscan4d UTSW 7 11165095 missense probably damaging 0.99
R2912:Zscan4d UTSW 7 11162687 missense probably benign
R3736:Zscan4d UTSW 7 11162876 missense probably benign
R4379:Zscan4d UTSW 7 11164978 missense probably benign
R4580:Zscan4d UTSW 7 11162508 missense probably benign 0.00
R4765:Zscan4d UTSW 7 11162667 missense probably benign 0.08
R4975:Zscan4d UTSW 7 11165347 start codon destroyed probably null 0.02
R6452:Zscan4d UTSW 7 11162072 missense probably damaging 0.98
R6570:Zscan4d UTSW 7 11162000 missense possibly damaging 0.92
R7726:Zscan4d UTSW 7 11165242 missense possibly damaging 0.65
R7772:Zscan4d UTSW 7 11162843 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AAGGCTCCTGGCATGTTTG -3'
(R):5'- TTGCTATAACACTTCCAGGAATGC -3'

Sequencing Primer
(F):5'- CCTGGCATGTTTGAACATCCTAGAAC -3'
(R):5'- TTCCAGGAATGCAGCTACTC -3'
Posted On2018-07-23