Incidental Mutation 'R6680:Sox6'
ID527451
Institutional Source Beutler Lab
Gene Symbol Sox6
Ensembl Gene ENSMUSG00000051910
Gene NameSRY (sex determining region Y)-box 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6680 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location115470872-116038796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 115476983 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 765 (E765K)
Ref Sequence ENSEMBL: ENSMUSP00000102223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072804] [ENSMUST00000106612] [ENSMUST00000166207] [ENSMUST00000166877] [ENSMUST00000169129] [ENSMUST00000205405] [ENSMUST00000206034] [ENSMUST00000206369]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072804
AA Change: E807K

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072583
Gene: ENSMUSG00000051910
AA Change: E807K

DomainStartEndE-ValueType
coiled coil region 184 261 N/A INTRINSIC
low complexity region 462 484 N/A INTRINSIC
low complexity region 507 517 N/A INTRINSIC
HMG 619 689 1.5e-25 SMART
low complexity region 797 809 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106612
AA Change: E765K

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102223
Gene: ENSMUSG00000051910
AA Change: E765K

DomainStartEndE-ValueType
coiled coil region 184 261 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
low complexity region 420 442 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
HMG 577 647 1.5e-25 SMART
low complexity region 755 767 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166207
AA Change: E807K

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129027
Gene: ENSMUSG00000051910
AA Change: E807K

DomainStartEndE-ValueType
coiled coil region 184 261 N/A INTRINSIC
low complexity region 462 484 N/A INTRINSIC
low complexity region 507 517 N/A INTRINSIC
HMG 619 689 1.5e-25 SMART
low complexity region 797 809 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166877
AA Change: E767K

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129512
Gene: ENSMUSG00000051910
AA Change: E767K

DomainStartEndE-ValueType
coiled coil region 184 263 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
low complexity region 422 444 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
HMG 579 649 1.5e-25 SMART
low complexity region 757 769 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169129
AA Change: E767K

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126404
Gene: ENSMUSG00000051910
AA Change: E767K

DomainStartEndE-ValueType
coiled coil region 184 263 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
low complexity region 422 444 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
HMG 579 649 1.5e-25 SMART
low complexity region 757 769 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000205405
AA Change: E808K

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000206034
AA Change: E766K

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000206369
AA Change: E808K

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1376 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: This gene encodes a member of a family of transcriptional regulators containing high mobility group (HMG) DNA-binding domains. Function of the encoded protein is important for proper cardiac and skeletal development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for null mutations exhibit cardioskeletal myopathy, cardiac blockage, delayed growth, and early postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A G 9: 105,143,574 S163P probably damaging Het
Adgre4 A G 17: 55,791,959 K155R probably benign Het
Ankrd31 T A 13: 96,830,609 probably null Het
AW011738 A G 4: 156,203,725 probably benign Het
Ccl3 A G 11: 83,648,306 S76P probably benign Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Fat2 G T 11: 55,310,858 Y463* probably null Het
Frem3 A G 8: 80,669,320 T1915A probably damaging Het
Gm36028 T C 16: 37,856,174 D77G probably benign Het
Hspg2 A G 4: 137,565,737 Q4162R probably benign Het
Krt87 C T 15: 101,433,978 R293H probably damaging Het
Mipep A G 14: 60,788,223 I143V possibly damaging Het
Mrc2 C T 11: 105,325,753 R123C probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Ndc80 T C 17: 71,517,545 K223R probably null Het
Nuf2 A C 1: 169,515,009 probably null Het
Olfr1055 T A 2: 86,347,245 I174F probably damaging Het
Olfr33 T A 7: 102,714,315 I33F possibly damaging Het
Olfr935 T C 9: 38,994,658 Y259C probably damaging Het
Omd T C 13: 49,589,528 V18A possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Shank2 A G 7: 144,420,866 S1384G probably damaging Het
Slc22a28 A G 19: 8,101,393 S311P probably benign Het
Tas2r106 A T 6: 131,678,474 I138K probably damaging Het
Tbx15 T A 3: 99,313,073 Y54* probably null Het
Tulp4 T G 17: 6,139,037 W45G probably damaging Het
Ugt3a2 T C 15: 9,370,068 Y433H probably damaging Het
Usp13 T C 3: 32,881,469 V348A probably damaging Het
Vezf1 T C 11: 88,081,584 I439T probably benign Het
Vmn2r93 C A 17: 18,316,658 Y534* probably null Het
Wdr92 T C 11: 17,229,857 L286P probably damaging Het
Zfp579 A G 7: 4,993,502 L470P probably damaging Het
Zfp598 A G 17: 24,678,686 N327S probably benign Het
Zscan4d A T 7: 11,162,439 S335T possibly damaging Het
Other mutations in Sox6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Sox6 APN 7 115477206 missense probably benign
IGL00957:Sox6 APN 7 115777092 missense probably damaging 1.00
IGL01624:Sox6 APN 7 115476968 missense probably damaging 1.00
IGL02057:Sox6 APN 7 115550075 missense probably damaging 1.00
IGL02385:Sox6 APN 7 115550039 missense possibly damaging 0.77
IGL02410:Sox6 APN 7 115486744 missense probably damaging 1.00
IGL02736:Sox6 APN 7 115580640 missense probably damaging 1.00
IGL02747:Sox6 APN 7 115489746 missense probably damaging 1.00
IGL02792:Sox6 APN 7 115541649 missense probably benign
PIT4480001:Sox6 UTSW 7 115597509 missense probably benign 0.03
R0458:Sox6 UTSW 7 115489794 missense probably damaging 1.00
R0689:Sox6 UTSW 7 115486551 missense probably damaging 1.00
R0800:Sox6 UTSW 7 115579014 critical splice donor site probably null
R1220:Sox6 UTSW 7 115662442 missense probably damaging 1.00
R1474:Sox6 UTSW 7 115701691 splice site probably benign
R1547:Sox6 UTSW 7 115701722 missense possibly damaging 0.93
R1570:Sox6 UTSW 7 115777123 missense probably damaging 1.00
R1674:Sox6 UTSW 7 115801419 missense probably benign 0.00
R1704:Sox6 UTSW 7 115476948 missense possibly damaging 0.92
R1754:Sox6 UTSW 7 115477055 missense probably benign
R1833:Sox6 UTSW 7 115777093 missense probably damaging 1.00
R1868:Sox6 UTSW 7 115659538 missense possibly damaging 0.89
R1893:Sox6 UTSW 7 115544568 missense probably benign 0.28
R2386:Sox6 UTSW 7 115597505 missense probably damaging 1.00
R2431:Sox6 UTSW 7 115550007 splice site probably null
R4303:Sox6 UTSW 7 115544469 critical splice donor site probably null
R4319:Sox6 UTSW 7 115580563 critical splice donor site probably null
R4320:Sox6 UTSW 7 115580563 critical splice donor site probably null
R4321:Sox6 UTSW 7 115580563 critical splice donor site probably null
R4323:Sox6 UTSW 7 115580563 critical splice donor site probably null
R4335:Sox6 UTSW 7 115512724 missense probably benign
R4567:Sox6 UTSW 7 115662322 missense probably benign 0.26
R4776:Sox6 UTSW 7 115541670 missense probably damaging 1.00
R4838:Sox6 UTSW 7 115486662 missense probably damaging 1.00
R4914:Sox6 UTSW 7 115476964 missense probably damaging 1.00
R4915:Sox6 UTSW 7 115476964 missense probably damaging 1.00
R5184:Sox6 UTSW 7 115777228 missense probably damaging 1.00
R5372:Sox6 UTSW 7 115550151 nonsense probably null
R5454:Sox6 UTSW 7 115701773 missense possibly damaging 0.89
R5663:Sox6 UTSW 7 115550054 missense probably benign
R5685:Sox6 UTSW 7 115579157 intron probably null
R5734:Sox6 UTSW 7 115541621 critical splice donor site probably null
R6020:Sox6 UTSW 7 115486628 missense probably damaging 1.00
R6211:Sox6 UTSW 7 115801462 missense probably damaging 1.00
R6263:Sox6 UTSW 7 115477060 missense probably damaging 1.00
R6549:Sox6 UTSW 7 115486692 missense possibly damaging 0.79
R6576:Sox6 UTSW 7 115701702 missense probably damaging 0.96
R6709:Sox6 UTSW 7 115701789 splice site probably null
R6747:Sox6 UTSW 7 115541731 missense probably damaging 1.00
R6755:Sox6 UTSW 7 115662442 missense probably damaging 0.99
R7233:Sox6 UTSW 7 115489809 missense possibly damaging 0.80
R7423:Sox6 UTSW 7 115550023 missense probably benign 0.30
R7455:Sox6 UTSW 7 115489669 missense probably benign 0.02
R7522:Sox6 UTSW 7 115801578 missense probably damaging 1.00
R7527:Sox6 UTSW 7 115777173 missense probably benign 0.00
R7852:Sox6 UTSW 7 115801604 start codon destroyed probably null 1.00
R7935:Sox6 UTSW 7 115801604 start codon destroyed probably null 1.00
X0061:Sox6 UTSW 7 115477148 missense probably benign 0.00
X0065:Sox6 UTSW 7 115550108 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGTCTCACACGTTACGAAGC -3'
(R):5'- GCTATTACTATGGCAACGACCAC -3'

Sequencing Primer
(F):5'- CGAAGCAATTAAGACCATTCTGCTG -3'
(R):5'- TACTATGGCAACGACCACACCATC -3'
Posted On2018-07-23