Mutagenetix > Incidental Mutations

Incidental Mutation 'R6680:Frem3'

527453

Institutional Source

Beutler Lab

Gene Symbol

Frem3

Ensembl Gene

ENSMUSG00000042353

Gene Name

Fras1 related extracellular matrix protein 3

Synonyms

LOC333315

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.104) question?

Stock #

R6680 (G1)

Quality Score

154.008

Status

Validated

Chromosome

Chromosomal Location

80611080-80695356 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80669320 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1915 (T1915A)

Ref Sequence

ENSEMBL: ENSMUSP00000038015 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039695]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039695
AA Change: T1915A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: T1915A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Cadherin_3	369	515	9.5e-31	PFAM
Pfam:Cadherin_3	495	596	9.4e-20	PFAM
Pfam:Cadherin_3	637	786	4.2e-20	PFAM
Pfam:Cadherin_3	788	913	5.5e-23	PFAM
Pfam:Cadherin_3	998	1163	1.8e-20	PFAM
Pfam:Cadherin_3	1129	1254	1.3e-19	PFAM
Pfam:Cadherin_3	1250	1395	9.5e-34	PFAM
Pfam:Cadherin_3	1397	1508	2.7e-21	PFAM
Pfam:Cadherin_3	1493	1617	1.2e-27	PFAM
Pfam:Cadherin_3	1622	1748	4.8e-17	PFAM
Calx_beta	1754	1853	1.45e-7	SMART
Calx_beta	1866	1977	3.35e-12	SMART
Calx_beta	1991	2098	1.61e-5	SMART

Meta Mutation Damage Score

0.7389

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700080E11Rik	A	G	9: 105,143,574	S163P	probably damaging	Het
Adgre4	A	G	17: 55,791,959	K155R	probably benign	Het
Ankrd31	T	A	13: 96,830,609		probably null	Het
AW011738	A	G	4: 156,203,725		probably benign	Het
Ccl3	A	G	11: 83,648,306	S76P	probably benign	Het
Col5a3	C	T	9: 20,779,033	G1162R	probably damaging	Het
Fat2	G	T	11: 55,310,858	Y463*	probably null	Het
Gm36028	T	C	16: 37,856,174	D77G	probably benign	Het
Hspg2	A	G	4: 137,565,737	Q4162R	probably benign	Het
Krt87	C	T	15: 101,433,978	R293H	probably damaging	Het
Mipep	A	G	14: 60,788,223	I143V	possibly damaging	Het
Mrc2	C	T	11: 105,325,753	R123C	probably damaging	Het
Myo1c	C	T	11: 75,671,635	P918S	probably benign	Het
Ndc80	T	C	17: 71,517,545	K223R	probably null	Het
Nuf2	A	C	1: 169,515,009		probably null	Het
Olfr1055	T	A	2: 86,347,245	I174F	probably damaging	Het
Olfr33	T	A	7: 102,714,315	I33F	possibly damaging	Het
Olfr935	T	C	9: 38,994,658	Y259C	probably damaging	Het
Omd	T	C	13: 49,589,528	V18A	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Shank2	A	G	7: 144,420,866	S1384G	probably damaging	Het
Slc22a28	A	G	19: 8,101,393	S311P	probably benign	Het
Sox6	C	T	7: 115,476,983	E765K	possibly damaging	Het
Tas2r106	A	T	6: 131,678,474	I138K	probably damaging	Het
Tbx15	T	A	3: 99,313,073	Y54*	probably null	Het
Tulp4	T	G	17: 6,139,037	W45G	probably damaging	Het
Ugt3a2	T	C	15: 9,370,068	Y433H	probably damaging	Het
Usp13	T	C	3: 32,881,469	V348A	probably damaging	Het
Vezf1	T	C	11: 88,081,584	I439T	probably benign	Het
Vmn2r93	C	A	17: 18,316,658	Y534*	probably null	Het
Wdr92	T	C	11: 17,229,857	L286P	probably damaging	Het
Zfp579	A	G	7: 4,993,502	L470P	probably damaging	Het
Zfp598	A	G	17: 24,678,686	N327S	probably benign	Het
Zscan4d	A	T	7: 11,162,439	S335T	possibly damaging	Het

Other mutations in Frem3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Frem3	APN	8	80668810	missense	possibly damaging	0.75
IGL01019:Frem3	APN	8	80615134	missense	probably benign	0.02
IGL01470:Frem3	APN	8	80614315	missense	probably damaging	1.00
IGL01609:Frem3	APN	8	80612704	missense	probably benign	0.00
IGL01622:Frem3	APN	8	80613915	missense	probably benign	0.01
IGL01623:Frem3	APN	8	80613915	missense	probably benign	0.01
IGL01751:Frem3	APN	8	80615743	missense	probably benign	0.33
IGL02037:Frem3	APN	8	80611489	missense	probably benign	0.31
IGL02039:Frem3	APN	8	80612971	missense	probably damaging	1.00
IGL02084:Frem3	APN	8	80612443	missense	possibly damaging	0.95
IGL02124:Frem3	APN	8	80613094	missense	probably damaging	0.99
IGL02140:Frem3	APN	8	80614107	missense	possibly damaging	0.84
IGL02836:Frem3	APN	8	80614381	missense	probably benign
IGL03090:Frem3	APN	8	80618229	missense	probably benign	0.01
IGL03102:Frem3	APN	8	80613032	missense	possibly damaging	0.92
IGL03116:Frem3	APN	8	80612806	missense	possibly damaging	0.84
IGL03165:Frem3	APN	8	80612529	missense	probably benign	0.26
IGL03224:Frem3	APN	8	80613463	missense	probably damaging	1.00
IGL03401:Frem3	APN	8	80614541	missense	probably damaging	1.00
IGL03403:Frem3	APN	8	80611090	missense	probably benign	0.04
FR4340:Frem3	UTSW	8	80615241	small insertion	probably benign
FR4976:Frem3	UTSW	8	80615241	small insertion	probably benign
IGL02991:Frem3	UTSW	8	80668882	missense	probably damaging	1.00
IGL03052:Frem3	UTSW	8	80614530	missense	probably damaging	1.00
R0089:Frem3	UTSW	8	80615878	missense	possibly damaging	0.94
R0647:Frem3	UTSW	8	80615185	missense	probably damaging	1.00
R0690:Frem3	UTSW	8	80613952	missense	possibly damaging	0.84
R0766:Frem3	UTSW	8	80615322	missense	probably benign
R0834:Frem3	UTSW	8	80687008	missense	probably damaging	1.00
R0909:Frem3	UTSW	8	80663406	missense	probably benign	0.45
R1033:Frem3	UTSW	8	80695157	missense	probably benign	0.00
R1144:Frem3	UTSW	8	80611884	missense	probably benign	0.01
R1312:Frem3	UTSW	8	80615322	missense	probably benign
R1330:Frem3	UTSW	8	80668839	missense	probably damaging	0.99
R1355:Frem3	UTSW	8	80690702	missense	probably damaging	1.00
R1390:Frem3	UTSW	8	80690773	missense	probably damaging	0.99
R1413:Frem3	UTSW	8	80668801	missense	probably benign
R1470:Frem3	UTSW	8	80611191	missense	probably benign	0.05
R1470:Frem3	UTSW	8	80611191	missense	probably benign	0.05
R1503:Frem3	UTSW	8	80687018	missense	probably damaging	0.99
R1538:Frem3	UTSW	8	80612710	missense	probably damaging	1.00
R1538:Frem3	UTSW	8	80613135	missense	probably benign	0.00
R1612:Frem3	UTSW	8	80614861	missense	probably damaging	1.00
R1793:Frem3	UTSW	8	80613112	missense	probably benign	0.03
R1872:Frem3	UTSW	8	80612576	missense	probably damaging	1.00
R1879:Frem3	UTSW	8	80611938	nonsense	probably null
R1886:Frem3	UTSW	8	80613885	missense	probably benign	0.00
R1933:Frem3	UTSW	8	80612890	missense	probably benign	0.00
R2027:Frem3	UTSW	8	80695337	missense	possibly damaging	0.75
R2040:Frem3	UTSW	8	80615826	missense	possibly damaging	0.92
R2050:Frem3	UTSW	8	80614891	missense	probably damaging	1.00
R2079:Frem3	UTSW	8	80615103	missense	probably benign	0.03
R2099:Frem3	UTSW	8	80615859	missense	probably benign	0.06
R2120:Frem3	UTSW	8	80615457	missense	probably benign	0.20
R2842:Frem3	UTSW	8	80669349	splice site	probably null
R2845:Frem3	UTSW	8	80613220	missense	probably damaging	1.00
R3015:Frem3	UTSW	8	80690773	missense	probably damaging	0.99
R3442:Frem3	UTSW	8	80613040	missense	probably damaging	1.00
R3724:Frem3	UTSW	8	80615271	missense	probably benign	0.06
R3730:Frem3	UTSW	8	80615916	missense	probably damaging	0.99
R3939:Frem3	UTSW	8	80615020	missense	possibly damaging	0.84
R3940:Frem3	UTSW	8	80615020	missense	possibly damaging	0.84
R3941:Frem3	UTSW	8	80615020	missense	possibly damaging	0.84
R4089:Frem3	UTSW	8	80615173	missense	probably damaging	1.00
R4282:Frem3	UTSW	8	80614141	missense	probably benign	0.00
R4437:Frem3	UTSW	8	80612607	missense	probably benign	0.30
R4480:Frem3	UTSW	8	80611357	missense	probably benign	0.10
R4575:Frem3	UTSW	8	80616075	missense	probably benign	0.17
R4583:Frem3	UTSW	8	80613514	missense	probably benign	0.03
R4620:Frem3	UTSW	8	80668957	missense	possibly damaging	0.82
R4621:Frem3	UTSW	8	80669191	splice site	probably null
R4644:Frem3	UTSW	8	80613727	missense	probably benign	0.33
R4667:Frem3	UTSW	8	80663420	missense	probably damaging	0.97
R4748:Frem3	UTSW	8	80611459	missense	probably damaging	1.00
R4823:Frem3	UTSW	8	80613958	missense	probably benign	0.25
R4836:Frem3	UTSW	8	80663397	missense	probably damaging	0.99
R4867:Frem3	UTSW	8	80613283	missense	probably damaging	1.00
R4921:Frem3	UTSW	8	80613136	missense	possibly damaging	0.83
R5030:Frem3	UTSW	8	80613247	missense	possibly damaging	0.89
R5035:Frem3	UTSW	8	80615914	missense	probably damaging	0.97
R5172:Frem3	UTSW	8	80612566	missense	probably benign	0.44
R5289:Frem3	UTSW	8	80612319	missense	probably benign	0.00
R5492:Frem3	UTSW	8	80612677	missense	probably damaging	1.00
R5655:Frem3	UTSW	8	80612694	missense	probably benign	0.00
R5685:Frem3	UTSW	8	80695303	missense	probably damaging	1.00
R5723:Frem3	UTSW	8	80613397	missense	probably benign	0.02
R5743:Frem3	UTSW	8	80615778	missense	probably damaging	0.98
R5889:Frem3	UTSW	8	80614288	missense	probably damaging	1.00
R6048:Frem3	UTSW	8	80613433	missense	probably benign	0.03
R6057:Frem3	UTSW	8	80615587	missense	probably damaging	0.99
R6137:Frem3	UTSW	8	80615047	missense	probably benign
R6264:Frem3	UTSW	8	80615203	missense	probably damaging	1.00
R6339:Frem3	UTSW	8	80613015	missense	possibly damaging	0.84
R6418:Frem3	UTSW	8	80611152	missense	probably benign	0.08
R6773:Frem3	UTSW	8	80611815	missense	probably damaging	1.00
R6838:Frem3	UTSW	8	80612031	missense	probably damaging	1.00
R6928:Frem3	UTSW	8	80611282	missense	possibly damaging	0.48
R6939:Frem3	UTSW	8	80615145	missense	probably benign	0.23
R6995:Frem3	UTSW	8	80612579	missense	probably damaging	0.98
R7112:Frem3	UTSW	8	80612031	missense	probably damaging	1.00
R7155:Frem3	UTSW	8	80616039	missense	probably benign	0.01
R7235:Frem3	UTSW	8	80690725	missense	probably benign	0.00
R7282:Frem3	UTSW	8	80612031	missense	probably damaging	1.00
R7403:Frem3	UTSW	8	80616145	missense	probably damaging	1.00
R7422:Frem3	UTSW	8	80615763	missense	probably benign	0.00
R7485:Frem3	UTSW	8	80613336	missense	probably damaging	1.00
R7516:Frem3	UTSW	8	80612083	missense	probably damaging	0.99
R7858:Frem3	UTSW	8	80611721	nonsense	probably null
R7976:Frem3	UTSW	8	80611602	nonsense	probably null
R8171:Frem3	UTSW	8	80615240	missense	probably damaging	1.00
R8185:Frem3	UTSW	8	80612304	nonsense	probably null
R8306:Frem3	UTSW	8	80612211	missense	possibly damaging	0.95
R8478:Frem3	UTSW	8	80611558	missense	probably damaging	1.00
R8518:Frem3	UTSW	8	80612595	missense	probably damaging	1.00
RF030:Frem3	UTSW	8	80615238	small insertion	probably benign
RF034:Frem3	UTSW	8	80615238	small insertion	probably benign
RF042:Frem3	UTSW	8	80615238	small insertion	probably benign
X0024:Frem3	UTSW	8	80613081	missense	possibly damaging	0.76
X0027:Frem3	UTSW	8	80612388	nonsense	probably null
Z1088:Frem3	UTSW	8	80615426	missense	probably benign	0.04
Z1176:Frem3	UTSW	8	80611503	missense	probably damaging	0.99
Z1176:Frem3	UTSW	8	80615431	missense	probably benign	0.03
Z1177:Frem3	UTSW	8	80616129	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- GCATGCTTCTTTCTGCGTAG -3'
(R):5'- TGCTCGAAGGAGACCAAATAGC -3'

Sequencing Primer
(F):5'- CTGCGTAGGTGTGATAAAATACC -3'
(R):5'- TCTCAGAGCACCTCAGCG -3'

Posted On

2018-07-23