Incidental Mutation 'R6680:Wdr92'
ID527457
Institutional Source Beutler Lab
Gene Symbol Wdr92
Ensembl Gene ENSMUSG00000078970
Gene NameWD repeat domain 92
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R6680 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location17182107-17233796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17229857 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 286 (L286P)
Ref Sequence ENSEMBL: ENSMUSP00000040938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046955]
Predicted Effect probably damaging
Transcript: ENSMUST00000046955
AA Change: L286P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040938
Gene: ENSMUSG00000078970
AA Change: L286P

DomainStartEndE-ValueType
WD40 55 96 6.88e0 SMART
WD40 100 145 5.15e-2 SMART
Blast:WD40 149 196 8e-27 BLAST
WD40 199 240 2.54e2 SMART
WD40 246 288 2.06e0 SMART
WD40 310 350 7.7e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151431
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two WD40 repeat domains thought to be involved in an apoptosis via activation of caspase-3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A G 9: 105,143,574 S163P probably damaging Het
Adgre4 A G 17: 55,791,959 K155R probably benign Het
Ankrd31 T A 13: 96,830,609 probably null Het
AW011738 A G 4: 156,203,725 probably benign Het
Ccl3 A G 11: 83,648,306 S76P probably benign Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Fat2 G T 11: 55,310,858 Y463* probably null Het
Frem3 A G 8: 80,669,320 T1915A probably damaging Het
Gm36028 T C 16: 37,856,174 D77G probably benign Het
Hspg2 A G 4: 137,565,737 Q4162R probably benign Het
Krt87 C T 15: 101,433,978 R293H probably damaging Het
Mipep A G 14: 60,788,223 I143V possibly damaging Het
Mrc2 C T 11: 105,325,753 R123C probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Ndc80 T C 17: 71,517,545 K223R probably null Het
Nuf2 A C 1: 169,515,009 probably null Het
Olfr1055 T A 2: 86,347,245 I174F probably damaging Het
Olfr33 T A 7: 102,714,315 I33F possibly damaging Het
Olfr935 T C 9: 38,994,658 Y259C probably damaging Het
Omd T C 13: 49,589,528 V18A possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Shank2 A G 7: 144,420,866 S1384G probably damaging Het
Slc22a28 A G 19: 8,101,393 S311P probably benign Het
Sox6 C T 7: 115,476,983 E765K possibly damaging Het
Tas2r106 A T 6: 131,678,474 I138K probably damaging Het
Tbx15 T A 3: 99,313,073 Y54* probably null Het
Tulp4 T G 17: 6,139,037 W45G probably damaging Het
Ugt3a2 T C 15: 9,370,068 Y433H probably damaging Het
Usp13 T C 3: 32,881,469 V348A probably damaging Het
Vezf1 T C 11: 88,081,584 I439T probably benign Het
Vmn2r93 C A 17: 18,316,658 Y534* probably null Het
Zfp579 A G 7: 4,993,502 L470P probably damaging Het
Zfp598 A G 17: 24,678,686 N327S probably benign Het
Zscan4d A T 7: 11,162,439 S335T possibly damaging Het
Other mutations in Wdr92
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Wdr92 APN 11 17232790 missense probably benign
IGL01801:Wdr92 APN 11 17219015 missense probably benign 0.00
IGL02573:Wdr92 APN 11 17212136 missense possibly damaging 0.92
IGL02985:Wdr92 APN 11 17229845 missense probably damaging 1.00
IGL03148:Wdr92 APN 11 17229845 missense probably damaging 1.00
IGL03147:Wdr92 UTSW 11 17229845 missense probably damaging 1.00
R0244:Wdr92 UTSW 11 17229851 missense probably damaging 1.00
R0276:Wdr92 UTSW 11 17229821 missense probably benign 0.33
R1013:Wdr92 UTSW 11 17228183 missense probably damaging 1.00
R1660:Wdr92 UTSW 11 17227183 missense probably benign 0.00
R2030:Wdr92 UTSW 11 17229832 missense probably benign
R4663:Wdr92 UTSW 11 17232853 missense probably benign 0.01
R4676:Wdr92 UTSW 11 17229794 missense probably benign 0.00
R4822:Wdr92 UTSW 11 17227165 missense probably damaging 1.00
R5328:Wdr92 UTSW 11 17222220 missense probably damaging 0.97
R5439:Wdr92 UTSW 11 17212031 missense possibly damaging 0.46
R5473:Wdr92 UTSW 11 17224591 missense probably damaging 0.99
R5642:Wdr92 UTSW 11 17227263 missense possibly damaging 0.89
R5771:Wdr92 UTSW 11 17224638 missense probably benign 0.00
R6889:Wdr92 UTSW 11 17222309 missense probably damaging 1.00
R7367:Wdr92 UTSW 11 17232712 missense probably damaging 1.00
R7693:Wdr92 UTSW 11 17212064 missense probably benign 0.25
R7785:Wdr92 UTSW 11 17229785 missense probably damaging 1.00
Z1176:Wdr92 UTSW 11 17228184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTACTCCTCAGCAAAACTGC -3'
(R):5'- TATTGTGTCAGAAAAGGGCAAC -3'

Sequencing Primer
(F):5'- CTGCTGGCTAAAATTAAAGCAAC -3'
(R):5'- AGCATCCTGGCATTGAAG -3'
Posted On2018-07-23