Incidental Mutation 'R6680:Ccl3'
ID527460
Institutional Source Beutler Lab
Gene Symbol Ccl3
Ensembl Gene ENSMUSG00000000982
Gene Namechemokine (C-C motif) ligand 3
SynonymsMIP-1alpha, MIP1-alpha, G0S19-1, LD78alpha, Mip1a, macrophage inflammatory protein-1alpha, Scya3, MIP-1 alpha, CCL3, MIP1-(a)
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6680 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location83647844-83649355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83648306 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 76 (S76P)
Ref Sequence ENSEMBL: ENSMUSP00000001008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001008] [ENSMUST00000182502]
Predicted Effect probably benign
Transcript: ENSMUST00000001008
AA Change: S76P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001008
Gene: ENSMUSG00000000982
AA Change: S76P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SCY 31 88 2.25e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117199
Predicted Effect probably benign
Transcript: ENSMUST00000182502
SMART Domains Protein: ENSMUSP00000138342
Gene: ENSMUSG00000081906

DomainStartEndE-ValueType
Pfam:Ribosomal_L6 12 87 1.2e-16 PFAM
Pfam:Ribosomal_L6 119 177 6.8e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of several cytokine genes that are clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins that function in inflammatory and immunoregulatory processes. The protein encoded by this gene binds to several chemokine receptors, including chemokine binding protein 2 and chemokine (C-C motif) receptor 5 (CCR5). CCR5 is a co-receptor for HIV, and binding of this protein to CCR5 inhibits HIV entry. The copy number of this gene varies among individuals, where most individuals have one to six copies, and a minority of individuals have zero or more than six copies. There are conflicting reports about copy number variation of this gene and its correlation to disease susceptibility.[provided by RefSeq, Apr 2014]
PHENOTYPE: Animals homozygous for a mutation in this gene exhibit resistance to Coxsackie virus-induced myocarditis and reduced pneumonitis following infection with influenza virus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A G 9: 105,143,574 S163P probably damaging Het
Adgre4 A G 17: 55,791,959 K155R probably benign Het
Ankrd31 T A 13: 96,830,609 probably null Het
AW011738 A G 4: 156,203,725 probably benign Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Fat2 G T 11: 55,310,858 Y463* probably null Het
Frem3 A G 8: 80,669,320 T1915A probably damaging Het
Gm36028 T C 16: 37,856,174 D77G probably benign Het
Hspg2 A G 4: 137,565,737 Q4162R probably benign Het
Krt87 C T 15: 101,433,978 R293H probably damaging Het
Mipep A G 14: 60,788,223 I143V possibly damaging Het
Mrc2 C T 11: 105,325,753 R123C probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Ndc80 T C 17: 71,517,545 K223R probably null Het
Nuf2 A C 1: 169,515,009 probably null Het
Olfr1055 T A 2: 86,347,245 I174F probably damaging Het
Olfr33 T A 7: 102,714,315 I33F possibly damaging Het
Olfr935 T C 9: 38,994,658 Y259C probably damaging Het
Omd T C 13: 49,589,528 V18A possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Shank2 A G 7: 144,420,866 S1384G probably damaging Het
Slc22a28 A G 19: 8,101,393 S311P probably benign Het
Sox6 C T 7: 115,476,983 E765K possibly damaging Het
Tas2r106 A T 6: 131,678,474 I138K probably damaging Het
Tbx15 T A 3: 99,313,073 Y54* probably null Het
Tulp4 T G 17: 6,139,037 W45G probably damaging Het
Ugt3a2 T C 15: 9,370,068 Y433H probably damaging Het
Usp13 T C 3: 32,881,469 V348A probably damaging Het
Vezf1 T C 11: 88,081,584 I439T probably benign Het
Vmn2r93 C A 17: 18,316,658 Y534* probably null Het
Wdr92 T C 11: 17,229,857 L286P probably damaging Het
Zfp579 A G 7: 4,993,502 L470P probably damaging Het
Zfp598 A G 17: 24,678,686 N327S probably benign Het
Zscan4d A T 7: 11,162,439 S335T possibly damaging Het
Other mutations in Ccl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Ccl3 APN 11 83648641 missense possibly damaging 0.80
R0549:Ccl3 UTSW 11 83648336 missense probably damaging 1.00
R4583:Ccl3 UTSW 11 83648338 missense probably benign 0.06
R5664:Ccl3 UTSW 11 83649213 missense probably benign 0.02
R5713:Ccl3 UTSW 11 83649240 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCTACTTGGCAGCAAACAGC -3'
(R):5'- CTCGTGCTTTTCCTGATAAAGTG -3'

Sequencing Primer
(F):5'- CAGCTTATAGGAGATGGAGCTATGC -3'
(R):5'- ACAGTGTAAGAGAGGGTTTTTCAGTC -3'
Posted On2018-07-23